ClinVar Miner

Submissions for variant NC_000009.12:g.35658022_35658023insTCTCAGCTTCACAGAGACCACGT

dbSNP: rs1823630124
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Labcorp Genetics (formerly Invitae), Labcorp RCV002035424 SCV002232512 pathogenic Anauxetic dysplasia 2023-08-29 criteria provided, single submitter clinical testing This variant is also known as "g.-20_+3dup23CTCTGTGAAGCTGAGAACGTGGT". For these reasons, this variant has been classified as Pathogenic. While functional studies for this variant have not been reported, experimental analyses using patient derived cells, as well as in vitro transfection studies, have shown that promoter insertions result in silencing of RMRP transcription and reduced expression of the gene product (PMID: 11207361, 16254002). ClinVar contains an entry for this variant (Variation ID: 1451935). This variant has been observed in individuals with cartilage-hair hypoplasia (PMID: 32021596). Other insertions and duplications immediately upstream of the coding sequence have been reported in individuals affected with cartilage-hair hypoplasia-anauxetic dysplasia (CHH-AD) spectrum disorders (PMID: 16244706, 11207361, 12107819). This variant is not present in population databases (gnomAD no frequency). This variant occurs in the RMRP gene, which encodes an RNA molecule that does not result in a protein product.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.