Total submissions: 1
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Labcorp Genetics |
RCV002035424 | SCV002232512 | pathogenic | Anauxetic dysplasia | 2023-08-29 | criteria provided, single submitter | clinical testing | This variant is also known as "g.-20_+3dup23CTCTGTGAAGCTGAGAACGTGGT". For these reasons, this variant has been classified as Pathogenic. While functional studies for this variant have not been reported, experimental analyses using patient derived cells, as well as in vitro transfection studies, have shown that promoter insertions result in silencing of RMRP transcription and reduced expression of the gene product (PMID: 11207361, 16254002). ClinVar contains an entry for this variant (Variation ID: 1451935). This variant has been observed in individuals with cartilage-hair hypoplasia (PMID: 32021596). Other insertions and duplications immediately upstream of the coding sequence have been reported in individuals affected with cartilage-hair hypoplasia-anauxetic dysplasia (CHH-AD) spectrum disorders (PMID: 16244706, 11207361, 12107819). This variant is not present in population databases (gnomAD no frequency). This variant occurs in the RMRP gene, which encodes an RNA molecule that does not result in a protein product. |