Total submissions: 1
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Labcorp Genetics |
RCV000548185 | SCV000630300 | pathogenic | Medium-chain acyl-coenzyme A dehydrogenase deficiency | 2017-09-24 | criteria provided, single submitter | clinical testing | For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss of function variants in ACADM are known to be pathogenic (PMID: 8198141, 20434380). This sequence change deletes 22 nucleotides from exon 11 of the ACADM mRNA (c.989_1010delTTGAACTAGCTAGAATGAGTTA), causing a frameshift at codon 330. This creates a premature translational stop signal (p.Val330Alafs*32) and is expected to result in an absent or disrupted protein product. |