ClinVar Miner

Submissions for variant NM_000016.6(ACADM):c.989_1010del (p.Val330fs)

dbSNP: rs1553127172
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Labcorp Genetics (formerly Invitae), Labcorp RCV000548185 SCV000630300 pathogenic Medium-chain acyl-coenzyme A dehydrogenase deficiency 2017-09-24 criteria provided, single submitter clinical testing For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss of function variants in ACADM are known to be pathogenic (PMID: 8198141, 20434380). This sequence change deletes 22 nucleotides from exon 11 of the ACADM mRNA (c.989_1010delTTGAACTAGCTAGAATGAGTTA), causing a frameshift at codon 330. This creates a premature translational stop signal (p.Val330Alafs*32) and is expected to result in an absent or disrupted protein product.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.