Submissions for variant NM_000018.4(ACADVL):c.507_527del (p.Met169_Gly175del)

dbSNP: rs796051920

Total submissions: 7

Submitter	RCV	SCV	Clinical significance	Condition	Last evaluated	Review status	Method	Comment
ClinGen ACADVL Variant Curation Expert Panel, ClinGen	RCV001200826	SCV004805218	uncertain significance	Very long chain acyl-CoA dehydrogenase deficiency	2024-02-27	reviewed by expert panel	curation	The NM_000018.4 c.507_527del (p.Met169_Gly175del) variant in ACADVL is an in-frame deletion (removes amino acids Met169_Gly175) in exon7/20 that is not predicted to impact splicing (SpliceAI: 0.0200). The highest population minor allele frequency in gnomAD v4.0.0 is 0.0001 in Middle Eastern population, which is lower than the ClinGen ACADVL Variant Curation Expert Panel threshold (<0.001) for PM2_Supporting, meeting this criterion (PM2_Supporting). The c.507_527del variant is predicted to cause a change in the length of the protein (p. Met169_Gly175del) due to an in-frame deletion of seven amino acids in a non-repeat region (PM4). This variant is reported in the literature in two individuals affected with very long-chain acyl-CoA dehydrogenase deficiency in a heterozygous fashion, who displayed elevated C14:1 carnitine level (0.8 and 1.14 µmol/L, respectively) during newborn screening and reduced VLCAD enzyme levels in the latter one of them, which is highly specific for VLCAD deficiency (PP4_Moderate, PMID: 31031081). Due to limited evidence, this variant is classified as a variant of uncertain significance for autosomal recessive very long chain acyl-CoA dehydrogenase (VLCAD) deficiency based on the ACMG/AMP criteria applied, as specified by the ClinGen ACADVL Variant Curation Expert Panel: PM2_Supporting, PM4, PP4_Moderate (ACADVL VCEP specifications version 1; approved November 9, 2021).
GeneDx	RCV000185744	SCV000238673	pathogenic	not provided	2014-09-23	criteria provided, single submitter	clinical testing	The c.507_527delGCATGACCTTGGCGTGGGCAT mutation causes an in-frame deletion of 7 amino acids starting at Methionine 169 and ending with Glycine 175, denoted Met169_Gly175del. This deletion occurs within a a region that is conserved in mammals and includes residues that are conserved across species. Missense mutations in this region (V174A, V174M) have been reported in association with very long chain acyl-CoA dehydrogenase (VLCAD) deficiency, supporting the functional importance of this region of the protein. Although this mutation has not been previously reported to our knowledge, we interpret c.507_527delGCATGACCTTGGCGTGGGCAT to be a pathogenic mutation. The variant is found in ACADVL panel(s).
Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine	RCV001200826	SCV001365027	uncertain significance	Very long chain acyl-CoA dehydrogenase deficiency	2019-11-01	criteria provided, single submitter	clinical testing	The NM_000018.3:c.507_527del21 (NP_000009.1:p.Met169_Gly175del) [GRCH38: NC_000017.11:g.7221567_7221587del] variant in ACADVL gene is interpretated to be Uncertain Significance based on ACMG guidelines (PMID: 25741868). This variant has been reported. This variant dose not meet any evidence codes reported in the ACMG guidelines.
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories	RCV001200826	SCV001473503	uncertain significance	Very long chain acyl-CoA dehydrogenase deficiency	2020-02-06	criteria provided, single submitter	clinical testing	The ACADVL c.507_527del21; p.Met169_Gly175del variant (rs1387074573) is reported in the literature in the heterozygous state in individuals affected with very long-chain acyl-CoA dehydrogenase deficiency (Rovelli 2019). This variant is reported in ClinVar (Variation ID: 203597), and is only observed on one allele in the Genome Aggregation Database, indicating it is not a common polymorphism. This variant deletes seven amino acid residues leaving the rest of the protein in-frame. Without functional studies, the effect on the protein is unknown. Due to limited information, the clinical significance of the p.Met169_Gly175del variant is uncertain at this time. References: Rovelli V et al. Clinical and biochemical outcome of patients with very long-chain acyl-CoA dehydrogenase deficiency. Mol Genet Metab. 2019 May;127(1):64-73.
Labcorp Genetics (formerly Invitae), Labcorp	RCV001200826	SCV001484054	pathogenic	Very long chain acyl-CoA dehydrogenase deficiency	2024-03-14	criteria provided, single submitter	clinical testing	This variant, c.507_527del, results in the deletion of 7 amino acid(s) of the ACADVL protein (p.Met169_Gly175del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs749299152, gnomAD 0.0009%). This variant has been observed in individual(s) with VLCAD deficiency (PMID: 31031081; Invitae; https//www.semanticscholar.org/paper/Prevalence-and-Genetic-Variability-of-Inborn-Errors-Al-Jishi-Alsahlawi/35fe29d36bd12f0fbe1020298d43d77eea5310f7). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 203597). This variant disrupts the p.Val174 amino acid residue in ACADVL. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 17999356, 18670371, 23430950, 26881790). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic.
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology	RCV001200826	SCV001736884	likely pathogenic	Very long chain acyl-CoA dehydrogenase deficiency	2021-04-26	criteria provided, single submitter	research	ACMG codes:PM1, PM2, PM4
Baylor Genetics	RCV001200826	SCV005058292	likely pathogenic	Very long chain acyl-CoA dehydrogenase deficiency	2023-11-09	criteria provided, single submitter	clinical testing