ClinVar Miner

Submissions for variant NM_000018.4(ACADVL):c.507_527del (p.Met169_Gly175del) (rs796051920)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
GeneDx RCV000185744 SCV000238673 pathogenic not provided 2014-09-23 criteria provided, single submitter clinical testing The c.507_527delGCATGACCTTGGCGTGGGCAT mutation causes an in-frame deletion of 7 amino acids starting at Methionine 169 and ending with Glycine 175, denoted Met169_Gly175del. This deletion occurs within a a region that is conserved in mammals and includes residues that are conserved across species. Missense mutations in this region (V174A, V174M) have been reported in association with very long chain acyl-CoA dehydrogenase (VLCAD) deficiency, supporting the functional importance of this region of the protein. Although this mutation has not been previously reported to our knowledge, we interpret c.507_527delGCATGACCTTGGCGTGGGCAT to be a pathogenic mutation. The variant is found in ACADVL panel(s).

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.