ClinVar Miner

Submissions for variant NM_000051.3(ATM):c.1888G>A (p.Val630Met) (rs148191382)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 6
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Ambry Genetics RCV000129681 SCV000184480 uncertain significance Hereditary cancer-predisposing syndrome 2018-02-19 criteria provided, single submitter clinical testing Lines of evidence used in support of classification: Insufficient or conflicting evidence,In silico models in agreement (benign) ,Insufficient evidence
Color RCV000129681 SCV000903507 likely benign Hereditary cancer-predisposing syndrome 2016-10-10 criteria provided, single submitter clinical testing
GeneDx RCV000590311 SCV000278812 uncertain significance not provided 2018-05-21 criteria provided, single submitter clinical testing This variant is denoted ATM c.1888G>A at the cDNA level, p.Val630Met (V630M) at the protein level, and results in the change of a Valine to a Methionine (GTG>ATG). This variant has been observed in a blood or bone marrow sample from a patient with chronic lymphocytic leukemia (CLL) (Jain 2016). ATM Val630Met was observed at an allele frequency of 0.045%, (15/33,478) in individuals of Latino ancestry in large population cohorts (Lek 2016). ATM Val630Met is not located in a known functional domain. In silico analysis, which includes protein predictors and evolutionary conservation, supports that this variant does not alter protein structure/function. Based on currently available evidence, it is unclear whether ATM Val630Met is pathogenic or benign. We consider it to be a variant of uncertain significance.
GeneKor MSA RCV000129681 SCV000821832 uncertain significance Hereditary cancer-predisposing syndrome 2018-08-01 criteria provided, single submitter clinical testing
Integrated Genetics/Laboratory Corporation of America RCV000590311 SCV000694203 uncertain significance not provided 2016-11-25 criteria provided, single submitter clinical testing Variant summary: The ATM c.1888G>A (p.Val630Met) variant involves the alteration of a non-conserved nucleotide. 4/4 in silico tools predict a benign outcome for this variant (SNPs&GO not captured due to low reliability index) and this variant is located outside of any known funcitonal domain of the protein. The variant was found in 9/114918 control chromosomes at a frequency of 0.0000783, which does not exceed the estimated maximal expected allele frequency of a pathogenic ATM variant (0.0010005). In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as uncertain significance. The variant of interest has not, to our knowledge, been reported in affected individuals via publications nor evaluated for functional impact by in vivo/vitro studies. One internal sample also carried a pathogenic variant BARD1 c.1935_1954dupTGAACAGGAAGAAAAGTATG/p.Glu652fsX69, suggesting non-pathogenic role of the variant of interest. Due to the absence of clinical information and lack of functional studies, the variant is classified as a variant of uncertain significance (VUS)-possibly benign until additional information becomes available.
Invitae RCV000234111 SCV000282883 likely benign Ataxia-telangiectasia syndrome 2017-11-01 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.