ClinVar Miner

Submissions for variant NM_000051.3(ATM):c.1888G>A (p.Val630Met) (rs148191382)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 8
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Ambry Genetics RCV000129681 SCV000184480 uncertain significance Hereditary cancer-predisposing syndrome 2019-02-26 criteria provided, single submitter clinical testing The p.V630M variant (also known as c.1888G>A), located in coding exon 11 of the ATM gene, results from a G to A substitution at nucleotide position 1888. The valine at codon 630 is replaced by methionine, an amino acid with highly similar properties. This amino acid position is not well conserved in available vertebrate species. In addition, this alteration is predicted to be tolerated by in silico analysis. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
GeneDx RCV000590311 SCV000278812 uncertain significance not provided 2021-02-09 criteria provided, single submitter clinical testing In silico analysis supports that this missense variant does not alter protein structure/function; Observed in individuals with a personal or family history including breast, ovarian, and other cancers, as well as in unaffected controls (Jain 2016, Momozawa 2018, Tsaousis 2019, Mizukami 2020); This variant is associated with the following publications: (PMID: 27468087, 30287823, 31159747, 32980694)
Invitae RCV001079129 SCV000282883 likely benign Ataxia-telangiectasia syndrome 2020-11-25 criteria provided, single submitter clinical testing
Women's Health and Genetics/Laboratory Corporation of America, LabCorp RCV000590311 SCV000694203 uncertain significance not provided 2016-11-25 criteria provided, single submitter clinical testing Variant summary: The ATM c.1888G>A (p.Val630Met) variant involves the alteration of a non-conserved nucleotide. 4/4 in silico tools predict a benign outcome for this variant (SNPs&GO not captured due to low reliability index) and this variant is located outside of any known funcitonal domain of the protein. The variant was found in 9/114918 control chromosomes at a frequency of 0.0000783, which does not exceed the estimated maximal expected allele frequency of a pathogenic ATM variant (0.0010005). In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as uncertain significance. The variant of interest has not, to our knowledge, been reported in affected individuals via publications nor evaluated for functional impact by in vivo/vitro studies. One internal sample also carried a pathogenic variant BARD1 c.1935_1954dupTGAACAGGAAGAAAAGTATG/p.Glu652fsX69, suggesting non-pathogenic role of the variant of interest. Due to the absence of clinical information and lack of functional studies, the variant is classified as a variant of uncertain significance (VUS)-possibly benign until additional information becomes available.
GeneKor MSA RCV000129681 SCV000821832 uncertain significance Hereditary cancer-predisposing syndrome 2018-08-01 criteria provided, single submitter clinical testing
Color Health, Inc RCV000129681 SCV000903507 likely benign Hereditary cancer-predisposing syndrome 2016-10-10 criteria provided, single submitter clinical testing
Department of Pathology and Laboratory Medicine,Sinai Health System RCV001356176 SCV001551267 uncertain significance Malignant tumor of breast no assertion criteria provided clinical testing The ATM p.Val630Met variant was identified in 1 of 972 proband chromosomes (frequency: 0.001) from individuals or families with chronic lymphocytic leukemia (Jain 2016). The variant was also identified in dbSNP (ID: rs148191382) as "With Uncertain significance allele", and in ClinVar (classified as likely benign by Invitae; as uncertain significance by Ambry Genetics, GeneDx, Integrated Genetics/Laboratory Corporation of America) databases. The variant was not identified in GeneInsight-COGR, Cosmic, MutDB, or LOVD 3.0 databases. The variant was identified in control databases in 24 of 245222 chromosomes (1 homozygous) at a frequency of 0.0001 increasing the likelihood this could be a low frequency benign variant (Genome Aggregation Database Feb 27, 2017). The variant was observed in the following populations: Other in 1 of 5462 chromosomes (freq: 0.0002), Latino in 15 of 33478 chromosomes (freq: 0.0004), European in 6 of 111122 chromosomes (freq: 0.00005), East Asian in 1 of 17216 chromosomes (freq: 0.00006), and South Asian in 1 of 30672 chromosomes (freq: 0.00003), while the variant was not observed in the African, Ashkenazi Jewish, and Finnish populations. The p.Val630 residue is not conserved in mammals and four out of five computational analyses (PolyPhen-2, SIFT, AlignGVGD, BLOSUM, MutationTaster) do not suggest a high likelihood of impact to the protein; however, this information is not predictive enough to rule out pathogenicity. The variant occurs outside of the splicing consensus sequence and in silico or computational prediction software programs (SpliceSiteFinder, MaxEntScan, NNSPLICE, GeneSplicer) do not predict a difference in splicing. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time. This variant is classified as a variant of uncertain significance.
Institute for Biomarker Research, Medical Diagnostic Laboratories, L.L.C. RCV000129681 SCV001950159 uncertain significance Hereditary cancer-predisposing syndrome 2021-09-15 no assertion criteria provided clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.