Total submissions: 3
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Evidence- |
RCV000661422 | SCV000783699 | pathogenic | Breast-ovarian cancer, familial, susceptibility to, 2 | 2017-12-15 | reviewed by expert panel | curation | Variant allele predicted to encode a truncated non-functional protein. |
Department of Pathology and Laboratory Medicine, |
RCV000502905 | SCV000591805 | likely pathogenic | Hereditary breast ovarian cancer syndrome | criteria provided, single submitter | clinical testing | ||
Ambry Genetics | RCV003159613 | SCV003855583 | pathogenic | Hereditary cancer-predisposing syndrome | 2023-01-10 | criteria provided, single submitter | clinical testing | The c.2398_2423dup26 pathogenic mutation, located in coding exon 10 of the BRCA2 gene, results from a duplication of GGTAACAATTATGAATCTGATGTTGA at nucleotide positions 2398 to 2423, causing a translational frameshift with a predicted alternate stop codon (p.L809Vfs*10). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. |