ClinVar Miner

Submissions for variant NM_000059.4(BRCA2):c.5319_5342del (p.Glu1773_Glu1780del)

dbSNP: rs1593905133
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 4
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Ambry Genetics RCV001023911 SCV001185854 uncertain significance Hereditary cancer-predisposing syndrome 2018-06-21 criteria provided, single submitter clinical testing The c.5319_5342del24 variant (also known as p.E1773_E1780del) is located in coding exon 10 of the BRCA2 gene. This variant results from an in-frame GCCAGTATTGAAGAATGTTGAAGA deletion at nucleotide positions 5319 to 5342. This results in the deletion of 8 amino acids (EPVLKNVE) between codons 1773 and 1780. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
Labcorp Genetics (formerly Invitae), Labcorp RCV001352614 SCV001547175 uncertain significance Hereditary breast ovarian cancer syndrome 2020-09-16 criteria provided, single submitter clinical testing This variant, c.5319_5342del, results in the deletion of 8 amino acid(s) of the BRCA2 protein (p.Glu1773_Glu1780del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with BRCA2-related conditions. ClinVar contains an entry for this variant (Variation ID: 825643). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Women's Health and Genetics/Laboratory Corporation of America, LabCorp RCV001797812 SCV002041865 uncertain significance not specified 2021-11-08 criteria provided, single submitter clinical testing Variant summary: BRCA2 c.5319_5342del24 (p.Glu1773_Glu1780del) results in an in-frame deletion that is predicted to remove 8 amino acids from the encoded protein, none of which are within any functional domains of the full length BRCA2 protein. The variant was absent in 250554 control chromosomes. To our knowledge, no occurrence of c.5319_5342del24 in individuals affected with Hereditary Breast And Ovarian Cancer Syndrome and no experimental evidence demonstrating its impact on protein function have been reported. Two clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. Both submitters classified the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as of uncertain significance.
Fulgent Genetics, Fulgent Genetics RCV005012450 SCV005633931 uncertain significance Familial cancer of breast; Breast-ovarian cancer, familial, susceptibility to, 2; Fanconi anemia complementation group D1; Medulloblastoma; Wilms tumor 1; Pancreatic cancer, susceptibility to, 2; Glioma susceptibility 3; Familial prostate cancer 2024-05-08 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.