ClinVar Miner

Submissions for variant NM_000070.2(CAPN3):c.643_663del(p.Ser215_Gly221del) (rs863224965)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 6
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Athena Diagnostics Inc RCV000379696 SCV000255670 pathogenic not provided 2016-05-27 criteria provided, single submitter clinical testing
Counsyl RCV000201156 SCV000794393 likely pathogenic Limb-girdle muscular dystrophy, type 2A 2017-09-28 criteria provided, single submitter clinical testing
EGL Genetic Diagnostics,Eurofins Clinical Diagnostics RCV000379696 SCV000331951 pathogenic not provided 2018-03-30 criteria provided, single submitter clinical testing
GeneDx RCV000379696 SCV000330275 pathogenic not provided 2017-10-30 criteria provided, single submitter clinical testing The c.643_663del21 pathogenic variant in the CAPN3 gene has been previously reported in both compound heterozygous and homozygous patients with LGMD2A and histological markers consistent with LGMD2A (Richard et al., 1997; Hauerslev et al., 2012). Additionally, c.643_663del21 was reported as a heterozygous variant in two individuals with features of LGMD2A. Although a second CAPN3 variant was not identified in these individuals, western blot analysis demonstrated highly reduced CAPN3 protein (Duno et al., 2008). The c.643_663del21 variant results in the deletion of seven amino acids, denoted as p.Ser215_Gly221del. This variant is not observed at a significant frequency in large population cohorts (Lek et al., 2016). This deletion occurs at a position that is conserved across species. Additionally, other in-frame deletions have been reported in the Human Gene Mutation Database in association with LGMD2A (Stenson et al., 2014). Therefore, we interpret c.643_663del21 as a pathogenic variant.
Invitae RCV000201156 SCV000645511 pathogenic Limb-girdle muscular dystrophy, type 2A 2018-11-09 criteria provided, single submitter clinical testing This sequence change deletes 21 nucleotides from exon 5 of the CAPN3 mRNA (c.643_663delTCCTACGAAGCTCTGAAAGGT). This leads to the deletion of 7 amino acid residues in the CAPN3 protein (p.Ser215_Gly221del) but otherwise preserves the integrity of the reading frame. The frequency data for this variant (rs772579407) in the population databases is unreliable, as metrics indicate poor quality at this position in the ExAC database. This variant has been reported to segregate with muscle disease (presenting as muscle weakness, pain, wasting, and/or elevated creatine phosphokinase) in 10 families showing autosomal dominant transmission. This is the first well-established report of autosomal dominant calpainopathy (PMID: 27259757, Invitae). This variant has also been reported in the homozygous state in 2 individuals affected with limb girdle muscular dystrophy type 2A (LGMD2A) (PMID: 22443334), and was also reported in combination with a second CAPN3 variant in a family affected with LGMD2A.  In this family the heterozygous carriers of this variant were not reported to be affected, however detailed clinical information on these individuals was not provided (PMID: 9150160).  ClinVar contains an entry for this variant (Variation ID: 217159). Experimental studies have shown that this in-frame deletion leads to a decrease in CAPN3 protein levels in muscle biopsies from affected individuals (PMID: 27259757, 22443334). For these reasons, this allele has been classified as Pathogenic.
OMIM RCV000681607 SCV000809046 pathogenic MUSCULAR DYSTROPHY, LIMB-GIRDLE, AUTOSOMAL DOMINANT 4 2018-09-26 no assertion criteria provided literature only

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.