ClinVar Miner

Submissions for variant NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) (rs587780668)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 6
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Ambry Genetics RCV000163609 SCV000214174 pathogenic Hereditary cancer-predisposing syndrome 2017-07-14 criteria provided, single submitter clinical testing Lines of evidence used in support of classification: Detected in individual satisfying established diagnostic critera for classic disease without a clear mutation,Deficient protein function in appropriate functional assay(s),Good segregation with disease (lod 1.5-3 = 5-9 meioses)
Color RCV000163609 SCV000689617 likely pathogenic Hereditary cancer-predisposing syndrome 2018-07-24 criteria provided, single submitter clinical testing
GeneDx RCV000160401 SCV000210933 likely pathogenic not provided 2018-12-19 criteria provided, single submitter clinical testing This in-frame duplication of 24 nucleotides in CDKN2A is denoted c.9_32dup24 at the cDNA level and p.Ala4_Pro11dup (A4_P11dup) at the protein level. The normal sequence, with the bases that are duplicated in brackets, is AGCC[dup24]TTCG. A majority of this duplication is not located in a known functional domain; however, a single residue is located in the ANK1 repeat (UniProt). Although this variant has been demonstrated to behave similar to wild-type in in-vitro CDK4 binding assays (Parry 1996, Monzon 1998, Becker 2005), Monzon et al. suggested these assays might not be optimal in assessing function since this duplication is located outside of the motifs that are believed to play a role in CDK4 binding. In addition, Becker et al. (2005) demonstrated that CDKN2A c.9_32dup24 showed weak S-phase inhibition, decreased inhibition of pRb phosphorylation, and retained some colony formation ability in further assays. Additionally, this variant has been observed in multiple melanoma families, and CDKN2A c.9_32dup24 has been reported to segregate with disease (Walker 1995, Flores 1997, Harland 1997, Goldstein 2004, Lang 2005, Eliason 2006, Demenais 2010, Wadt 2015). Based on available evidence, we consider CDKN2A Ala4_Pro11dup to be a likely pathogenic variant. Of note, CDKN2A c.9_32dup24 has been reported in the literature using several alternate nomenclatures. Thus, when reviewing the papers cited above, it may be reported as any one of the following: 23ins24, 1_24dup, c.24_47dup24, c.32_33ins24, c.32_33ins9_32, 1_8dup8, p.Met1_Ser8dup, and p.M1_S8dup.
Invitae RCV000122949 SCV000166207 likely pathogenic Hereditary cutaneous melanoma 2018-07-05 criteria provided, single submitter clinical testing This sequence change inserts 24 nucleotides in exon 1 of the CDKN2A (p16INK4a) mRNA (c.9_32dup24). This leads to the insertion of 8 amino acid residues in the p16INK4a protein (p.Ala4_Pro11dup) but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (rs587780668, ExAC no frequency). This variant has been reported in the literature in several individuals affected with melanoma (PMID: 9516223, 16307646, 25803691), and has been shown to segregate with disease in several melanoma families, although with reduced penetrance (PMID: 9328469, 8595405, 16397522, 9416844). This variant is also known as 32_33ins9-32, 32ins24, and 23ins24 in the literature. ClinVar contains two entries for this variant (Variation ID: 135827, 12337007). An experimental study has shown that cells expressing this variant exhibit weaker cell-cycle inhibition in comparison to wild-type, and retain colony formation ability (PMID: 15945100). However, two other experimental studies have shown that this variant does not affect the binding of the p16INK4a protein to CDK4 or CDK6 (PMID: 8668202, 9516223). The clinical significance of these results is unclear. In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic.
OMIM RCV000010023 SCV000030244 risk factor Cutaneous malignant melanoma 2 2010-06-01 no assertion criteria provided literature only
PreventionGenetics RCV000160401 SCV000805833 likely pathogenic not provided 2017-05-15 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.