ClinVar Miner

Submissions for variant NM_000077.4:c.206_229delAGCCCAACTGCGCCGACCCCGinsCAG

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
GeneDx RCV000160404 SCV000210936 pathogenic Hereditary cancer-predisposing syndrome 2013-10-30 criteria provided, single submitter clinical testing The CDKN2A c.206_229delinsCAG mutation causes an in-frame deletion of nine amino acids starting with Glutamic Acid 69 and ending with Threonine 77 and the insertion of two Alanine residues, denoted p.Glu69_Thr77delinsAlaAla. This in-frame deletion and insertion is expected to disrupt the protein structure and/or function. Although this mutation has not been previously reported to our knowledge, its presence is consistent with a risk to develop features of familial cutaneous malignant melanoma. This variant has been observed to be inherited. The variant is found in CDKN2A panel(s).

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.