ClinVar Miner

Submissions for variant NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del) (rs587780668)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 9
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV000197052 SCV000254246 uncertain significance Hereditary melanoma 2018-05-12 criteria provided, single submitter clinical testing This sequence change deletes 24 nucleotides from exon 1 of the CDKN2A (p16INK4a) mRNA (c.9_32del24). This leads to the deletion of 8 amino acid residues in the CDKN2A (p16INK4a) protein (p.Ala4_Pro11del) but otherwise preserves the integrity of the reading frame. The frequency data for this variant (rs751570838) in the population databases is unreliable, as metrics indicate poor quality at this position in the ExAC database. This variant has been reported in multiple individuals and families affected with melanoma (PMID: 19759551, 16905682, 20876876, 12072543, 25780468, 17047042, 25803691), and an individual with breast cancer (PMID: 26976419). ClinVar contains an entry for this variant (Variation ID: 216277). Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Counsyl RCV000409781 SCV000489283 uncertain significance Melanoma-pancreatic cancer syndrome 2016-09-13 criteria provided, single submitter clinical testing
GeneDx RCV000587112 SCV000564855 uncertain significance not provided 2020-11-09 criteria provided, single submitter clinical testing In-frame deletion of 8 amino acids in a non-repeat region Final deleted residue is located in the critical ANK1 repeat region (UniProt) Observed in families with multiple cases of melanoma, demonstrating incomplete segregation with disease in at least one family (Aitken 1999, Bishop 2002, Goldstein 2006, Goldstein 2007, Demenais 2010, Harland 2014, Wadt 2015) Observed in 0.0136% (36/265240 alleles) in large population cohorts (Lek 2016) In silico analysis supports a deleterious effect on protein structure/function
Ambry Genetics RCV000566263 SCV000669157 uncertain significance Hereditary cancer-predisposing syndrome 2020-08-18 criteria provided, single submitter clinical testing The c.9_32del24 variant (also known as p.A4_P11del) is located in coding exon 1 of the CDKN2A gene. This variant results from an in-frame deletion of 24 nucleotides at positions 9 through 32, causing the removal of 8 amino acids at codons 4 through 11. This variant has been identified in melanoma cohorts across multiple populations (Goldstein AM et al. J Med Genet. 2007 Feb; 44(2):99-106; Harland M et al. Hered Cancer Clin Pract. 2014 Nov 20;12(1):20; Wadt KA et al. PLoS ONE, 2015 Mar;10:e0122662). This amino acid region is poorly conserved on limited sequence alignment. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
Color Health, Inc RCV000566263 SCV000684538 uncertain significance Hereditary cancer-predisposing syndrome 2020-01-24 criteria provided, single submitter clinical testing
Women's Health and Genetics/Laboratory Corporation of America, LabCorp RCV001255216 SCV000695349 likely benign not specified 2020-08-13 criteria provided, single submitter clinical testing Variant summary: CDKN2A c.9_32del24 (p.Ala4_Pro11del) results in an in-frame deletion that is predicted to remove 8 amino acids from the encoded protein. The variant allele was found at a frequency of 0.00014 in 236110 control chromosomes, predominantly at a frequency of 0.00053 within the Latino subpopulation in the gnomAD database. The observed variant frequency within Latino control individuals in the gnomAD database is approximately 2 fold of the estimated maximal expected allele frequency for a pathogenic variant in CDKN2A causing Cutaneous Malignant Melanoma phenotype (0.0003), strongly suggesting that the variant is a benign polymorphism found primarily in populations of Latino origin. c.9_32del24 has been reported in the literature in individuals affected with Cutaneous Malignant Melanoma (Aitken_1999, Bishop_2002, Goldstein_2006, Goldstein_2007, Harland_2014, Wadt_2015, Cust_2011). However, these reports do not provide unequivocal conclusions about an association of the variant with Cutaneous Malignant Melanoma. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Eight clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as likely benign.
Mendelics RCV000709073 SCV000838333 uncertain significance Cutaneous malignant melanoma 2 2018-07-02 criteria provided, single submitter clinical testing
Quest Diagnostics Nichols Institute San Juan Capistrano RCV000587112 SCV000888062 uncertain significance not provided 2017-11-03 criteria provided, single submitter clinical testing
Mendelics RCV000409781 SCV001137782 uncertain significance Melanoma-pancreatic cancer syndrome 2019-05-28 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.