Submissions for variant NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del)

dbSNP: rs587780668

Total submissions: 12

Submitter	RCV	SCV	Clinical significance	Condition	Last evaluated	Review status	Method	Comment
Invitae	RCV000197052	SCV000254246	uncertain significance	Familial melanoma	2024-01-21	criteria provided, single submitter	clinical testing	This variant, c.9_32del, results in the deletion of 8 amino acid(s) of the CDKN2A (p16INK4a) protein (p.Ala4_Pro11del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs751570838, gnomAD 0.05%), and has an allele count higher than expected for a pathogenic variant. This variant has been observed in individual(s) with breast cancer and melanoma (PMID: 12072543, 16905682, 17047042, 19759551, 20876876, 25780468, 25803691, 26976419). ClinVar contains an entry for this variant (Variation ID: 216277). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Counsyl	RCV000409781	SCV000489283	uncertain significance	Melanoma-pancreatic cancer syndrome	2016-09-13	criteria provided, single submitter	clinical testing
GeneDx	RCV000587112	SCV000564855	uncertain significance	not provided	2023-06-12	criteria provided, single submitter	clinical testing	In-frame deletion of 8 amino acids in a non-repeat region; Observed in families with multiple cases of melanoma, demonstrating incomplete segregation with disease in at least one family, and in individuals with breast cancer (Aitken et al., 1999; Bishop et al., 2002; Goldstein et al., 2006; Goldstein et al., 2007; Demenais et al., 2010; Harland et al., 2014; Wadt et al., 2015; Tung et al., 2016; Guindalini et al., 2022); In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 17047042, 25780468, 10070944, 12072543, 16905682, 19759551, 25803691, 26976419, 20876876, 27196769, 21325014, 28830827, 16173922, 9653180, 9529249, 35264596)
Ambry Genetics	RCV000566263	SCV000669157	likely benign	Hereditary cancer-predisposing syndrome	2022-03-11	criteria provided, single submitter	clinical testing	This alteration is classified as likely benign based on a combination of the following: population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity.
Color Diagnostics, LLC DBA Color Health	RCV000566263	SCV000684538	uncertain significance	Hereditary cancer-predisposing syndrome	2023-02-21	criteria provided, single submitter	clinical testing	This variant results in a deletion of eight amino acids from the N-terminus of the CDKN2A (p16INK4A) protein. The residues deleted by this variant (p.Ala4_Pro11) are only present in human and two other non-human primate species. The mutant allele is a reference in other mammalian species (https://genome.ucsc.edu/). A functional study has shown that the mutant protein resulting from this variant retains normal protein function (PMID: 8668202). This variant has been reported in over ten individuals affected by melanoma (PMID: 10070944, 12072543, 16905682, 17047042, 19759551, 20876876, 21325014, 25780468, 25803691) and breast cancer (PMID: 26976419). This variant has also been identified in 36/265240 chromosomes in the general population by the Genome Aggregation Database (gnomAD) and is particularly common in the Latino population (0.0512%, 18/35104 alleles). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance.
Women's Health and Genetics/Laboratory Corporation of America, LabCorp	RCV001255216	SCV000695349	likely benign	not specified	2020-08-13	criteria provided, single submitter	clinical testing	Variant summary: CDKN2A c.9_32del24 (p.Ala4_Pro11del) results in an in-frame deletion that is predicted to remove 8 amino acids from the encoded protein. The variant allele was found at a frequency of 0.00014 in 236110 control chromosomes, predominantly at a frequency of 0.00053 within the Latino subpopulation in the gnomAD database. The observed variant frequency within Latino control individuals in the gnomAD database is approximately 2 fold of the estimated maximal expected allele frequency for a pathogenic variant in CDKN2A causing Cutaneous Malignant Melanoma phenotype (0.0003), strongly suggesting that the variant is a benign polymorphism found primarily in populations of Latino origin. c.9_32del24 has been reported in the literature in individuals affected with Cutaneous Malignant Melanoma (Aitken_1999, Bishop_2002, Goldstein_2006, Goldstein_2007, Harland_2014, Wadt_2015, Cust_2011). However, these reports do not provide unequivocal conclusions about an association of the variant with Cutaneous Malignant Melanoma. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Eight clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as likely benign.
Mendelics	RCV000709073	SCV000838333	uncertain significance	Melanoma, cutaneous malignant, susceptibility to, 2	2018-07-02	criteria provided, single submitter	clinical testing
Quest Diagnostics Nichols Institute San Juan Capistrano	RCV000587112	SCV000888062	uncertain significance	not provided	2017-11-03	criteria provided, single submitter	clinical testing
Mendelics	RCV000409781	SCV001137782	uncertain significance	Melanoma-pancreatic cancer syndrome	2019-05-28	criteria provided, single submitter	clinical testing
Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital	RCV001255216	SCV002760447	uncertain significance	not specified	2023-08-15	criteria provided, single submitter	clinical testing
Myriad Genetics, Inc.	RCV000409781	SCV004018547	uncertain significance	Melanoma-pancreatic cancer syndrome	2023-04-20	criteria provided, single submitter	clinical testing	This variant is classified as a variant of uncertain significance as there is insufficient evidence to determine its impact on protein function and/or cancer risk.
Baylor Genetics	RCV003474958	SCV004212475	uncertain significance	Melanoma and neural system tumor syndrome	2023-10-05	criteria provided, single submitter	clinical testing