Total submissions: 16
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Labcorp Genetics |
RCV000122949 | SCV000166207 | likely pathogenic | Familial melanoma | 2025-01-14 | criteria provided, single submitter | clinical testing | This variant, c.9_32dup, results in the insertion of 8 amino acid(s) of the CDKN2A (p16INK4a) protein (p.Ala4_Pro11dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs587780668, gnomAD 0.006%). This variant has been observed in individual(s) with melanoma (PMID: 8595405, 9328469, 9416844, 9516223, 16307646, 16397522, 25803691). It has also been observed to segregate with disease in related individuals. This variant is also known as 32_33ins9-32, 32ins24, and 23ins24. Algorithms developed to predict the effect of variants on gene product structure and function are not available or were not evaluated for this variant. Experimental studies are conflicting or provide insufficient evidence to determine the effect of this variant on CDKN2A (p16INK4a) function (PMID: 8668202, 9516223, 15945100). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. |
Gene |
RCV000160401 | SCV000210933 | pathogenic | not provided | 2023-08-04 | criteria provided, single submitter | clinical testing | In-frame insertion of 8 amino acids in a non-repeat region; Observed in individuals with a personal or family history of melanoma, pancreatic, and other cancers (Monzon et al., 1998; Pollock et al., 1998; Aitken et al., 1999; Bishop et al., 2002; Goldstein et al., 2004; Lang et al., 2005; Eliason et al., 2006; Niendorf et al., 2006; Wadt et al., 2015; Zhen et al., 2015; Panou et al., 2018); In silico analysis supports that this variant does not alter protein structure/function; Not observed at significant frequency in large population cohorts (gnomAD); Also known as 23ins24, 1_24dup, 24_47dup24, 32-33ins9-32, 32ins24, M1_S8dup; This variant is associated with the following publications: (PMID: 26207792, 16905682, 16169933, 8668202, 20876876, 10070944, 28135137, 12072543, 16397522, 9416844, 17047042, 9328469, 25780468, 19759551, 16307646, 9516223, 28135136, 11159196, 25803691, 8595405, 28492532, 27978560, 28971906, 15945100, 25356972, 20340136, 9603434, 7559077, 28986857, 30113886, 30117292, 15173226, 9529249, 9653180, 16173922) |
Ambry Genetics | RCV000163609 | SCV000214174 | pathogenic | Hereditary cancer-predisposing syndrome | 2024-09-05 | criteria provided, single submitter | clinical testing | The c.9_32dup24 pathogenic mutation (also known as p.A4_P11dup), located in coding exon 1 of the CDKN2A gene, results from an in-frame 24 nucleotide duplication between nucleotide positions 9 and 32. This results in the duplication of 8 extra amino acid residues between codons 4 and 11. This alteration has been shown to segregate with disease in multiple familial melanoma kindreds from several countries (Walker GJ et al. Hum. Mol. Genet. 1995 Oct;4:1845-52; Harland M et al. Hum. Mol. Genet. 1997 Nov;6:2061-7; Flores JF et al. Oncogene. 1997 Dec;15:2999-3005; Lang J et al. Br. J. Dermatol. 2005 Dec;153:1121-5; Eliason MJ et al. J. Invest. Dermatol. 2006 Mar;126:660-6). It has also been detected in a familial pancreatic cancer kindred as well as in individuals diagnosed with osteosarcoma, endometrial cancer, or colorectal cancer (Zhen DB et al. Genet. Med. 2015 Jul;17:569-77; Chan SH et al. Genomic Med. 2016;1; Pearlman R et al. JAMA Oncol. 2017 Apr 1;3(4):464-471). Several groups have performed in vitro assays to test for CDK4 binding and they have shown little impact on binding to CDK4 (Parry D and Peters G. Mol. Cell. Biol. 1996 Jul;16:3844-52; Monzon J et al. N. Engl. J. Med. 1998 Mar;38:879-87; Becker TM et al. Int. J. Cancer. 2005 Nov;117:569-73; McKenzie HA et al. Hum. Mutat. 2010 Jun;31:692-701). However, Becker et al. found this variant affects p16INK4a protein levels, its ability to inhibit S-phase when expressed at physiologic levels, and causes reduced phosphorylation of pRb, a downstream target. Of note, this alteration is also designated as 24 bp duplication/insertion, 23ins24, 32ins24, 32_33ins9-32, and p.M1_S8dup in published literature. Based on the available evidence, this alteration is classified as a pathogenic mutation. |
Color Diagnostics, |
RCV000163609 | SCV000689617 | pathogenic | Hereditary cancer-predisposing syndrome | 2025-03-24 | criteria provided, single submitter | clinical testing | The CDKN2A locus encodes two different gene products, p16INK4a and p14ARF (https://www.ncbi.nlm.nih.gov/books/NBK7030/). This variant causes an in-frame duplication of 8 amino acids in the N-terminus of the CDKN2A (p16INK4A) protein. This variant is also known as c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3], c.1_24dup, c.23ins24 p.Met1_Ser8dup, c.32_33ins9-32 and c.32ins24 in the literature. This variant has been reported in up to twenty individuals affected with melanoma (PMID: 8595405, 9328469, 9416844, 9516223, 16307646, 16397522, 16905682, 20340136, 25803691, 28830827) and has been shown to segregate with melanoma in multiple families, with incomplete penetrance observed in some families (PMID: 8595405, 9328469, 9416844, 16397522). This variant has been identified in 3/265240 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Functional studies have reported conflicting results regarding the variant impact on cell cycle regulation. One study has shown that the mutant protein exhibits a partial loss of cell cycle-inhibitory activity and induces weaker S-phase inhibition than the wild-type protein and that cells expressing this mutant protein retain colony formation ability (PMID: 15945100). In this study, the cell cycle-regulatory defect of the mutant protein was associated with decreased inhibition of pRb (retinoblastoma) protein phosphorylation. Another study has shown no deleterious effect on induction of S phase inhibition (PMID: 20340136). It has also been shown that the mutant protein retains the ability to bind to CDK4 and/or CDK6 in vitro (PMID: 8668202, 9516223, 15945100, 20340136). However, CDK4/CDK6 binding activity may not be the relevant molecular consequence of this variant, as the variant lies outside the ankyrin repeats that mediate CDK4/CDK6 binding (PMID: 8880901). Although the available functional studies have not produced consistent findings, clinical observations strongly indicate this variant is associated with disease. Therefore, this variant is classified as Pathogenic. |
Women's Health and Genetics/Laboratory Corporation of America, |
RCV000122949 | SCV001362182 | likely pathogenic | Familial melanoma | 2024-09-19 | criteria provided, single submitter | clinical testing | Variant summary: CDKN2A c.9_32dup24 (p.Ala4_Pro11dup) results in an in-frame insertion of an additional copy of a 24 nucleotide repeat sequence that is naturally present in two copies at the 5' end of the CDKN2A gene; and is predicted to result in an insertion of 8 amino acids into the N-terminal end of the p16 (INK4A) protein. The variant allele was found at a frequency of 8.5e-06 in 233942 control chromosomes. c.9_32dup24 has been reported in the literature in multiple individuals affected with melanoma, with evidence of co-segregation with disease in affected families, however with reduced penetrance (Eliason_2006, Morzon_1998, Flores_1997, Harland_1997, Walker_1995, Lang_2005). These data indicate that the variant is very likely to be associated with disease. One study providing experimental evidence for evaluation of an impact on protein function demonstrated diminished cell cycle-inhibitory activity which was associated with decreased inhibition of pRb phosphorylation, even though it effectively bound CDK4 (Becker_2005). However, two other studies found that the variant was fully active in mediating cell cycle arrest, showed wild-type subcellular localization and bound effectively to CDK4 and CDK6 (McKenzie_2010, Monzon_1998). The following publications have been ascertained in the context of this evaluation (PMID: 15945100, 16397522, 9416844, 9328469, 16307646, 20340136, 9516223, 25803691, 8595405). ClinVar contains an entry for this variant (Variation ID: 135827). Based on the evidence outlined above, the variant was classified as likely pathogenic. |
Genetic Services Laboratory, |
RCV000160401 | SCV002072289 | likely pathogenic | not provided | 2021-09-01 | criteria provided, single submitter | clinical testing | This in-frame duplication is predicted to result in the duplication of 8 amino acid residues, p.Ala4_Pro11dup. This sequence change has been reported in the literature in individuals with melanoma and has been reported to segregate with the disease in the multiple families with reduced penetrance (PMIDs: 9516223, 16307646, 25803691, 9416844, 16397522, 9328469). The c.9_32dup sequence change has been described in three heterozygous individuals in gnomAD which corresponds to the population frequency of 0.0011% (dbSNP rs587780668). Functional studies showed that this mutant protein had a normal binding activity similar to the wild-type and they attributed it to the 8 amino acid insertions being located outside of the ankyrin motifs that are thought to be involved in CDK4 binding (PMID: 9516223). This change has also been described as 24 bp duplication/insertion, 23ins24, 32ins24, 32_33ins9-32, and p.M1_S8dup in published literature. |
Ai |
RCV000160401 | SCV002502723 | likely pathogenic | not provided | 2021-08-18 | criteria provided, single submitter | clinical testing | |
Sema4, |
RCV000163609 | SCV002534352 | likely pathogenic | Hereditary cancer-predisposing syndrome | 2021-09-13 | criteria provided, single submitter | curation | |
Fulgent Genetics, |
RCV002498582 | SCV002812599 | likely pathogenic | Melanoma-pancreatic cancer syndrome; Melanoma, cutaneous malignant, susceptibility to, 2; Melanoma and neural system tumor syndrome | 2022-03-26 | criteria provided, single submitter | clinical testing | |
Baylor Genetics | RCV003474736 | SCV004212469 | likely pathogenic | Melanoma and neural system tumor syndrome | 2024-03-29 | criteria provided, single submitter | clinical testing | |
Quest Diagnostics Nichols Institute San Juan Capistrano | RCV000160401 | SCV004221647 | pathogenic | not provided | 2022-02-19 | criteria provided, single submitter | clinical testing | The frequency of this variant in the general population, 0.000011 (3/265240 chromosomes, http://gnomad.broadinstitute.org), is consistent with pathogenicity. In the published literature, the variant has been shown to co-segregate in multiple melanoma families (PMIDs: 8595405 (1995), 9328469 (1997), 9416844 (1997), 16307646 (2005)). It has also been identified in individuals affected with pancreatic cancer (PMID: 25356972 (2015)), colorectal cancer (PMIDs: 27978560 (2016), 28135145 (2017)), endometrial cancer (PMID: 29263814 (2016)), and osteosarcoma (PMID: 29263814 (2016)). Functional studies, however, have not conclusively identified the disease mechanism and some studies show that this variant retains most CDK4 binding activity (PMIDs: 8668202 (1996), 9516223 (1998), 20340136 (2010), 15945100 (2005)), cell cycle control (PMIDs: 8668202 (1996), 20340136 (2010)), and subcellular localization (PMID: 20340136 (2010)). In addition, one study described the variant as functionally impaired after showing it to have weaker cell cycle inhibition (PMID: 15945100 (2005)). Based on the available information, this variant is classified as pathogenic. |
Revvity Omics, |
RCV000160401 | SCV004238529 | likely pathogenic | not provided | 2023-09-29 | criteria provided, single submitter | clinical testing | |
Illumina Laboratory Services, |
RCV003985078 | SCV004801527 | pathogenic | Melanoma-pancreatic cancer syndrome | 2018-10-03 | criteria provided, single submitter | clinical testing | The CDKN2A c.9_32dup (p.Ala4_Pro11dup) variant has been reported in at least five studies and is found in eleven probands from eight families in a heterozygous state (Monzon et al. 1998; Goldstein et al. 2006; Eliason et al. 2006; Zhen et al. 2015; Wadt et al. 2015). Probands exhibited a range of phenotypes including melanoma and pancreatic cancer. Control data are unavailable for the p.Ala4_Pro11dup variant, which is reported at a frequency of 0.000011 in the Total population of the Genome Aggregation Database. Expression analysis in WMM1175 melanoma cells found weak S-phase inhibition, decreased inhibition of pRb phosphorylation, and is indicated to be associated with defective in controlling cell proliferation (Becker et al. 2005). Analysis using yeast two-hybrid assay found 80% binding activity compared to wildtype (Monzon et al. 1998). Based on the evidence, the c.9_32dup (p.Ala4_Pro11dup) variant is classified as pathogenic for melanoma-pancreatic cancer syndrome. |
Department of Pathology and Laboratory Medicine, |
RCV003985078 | SCV005912930 | likely pathogenic | Melanoma-pancreatic cancer syndrome | 2021-08-31 | criteria provided, single submitter | clinical testing | |
OMIM | RCV000010023 | SCV000030244 | risk factor | Melanoma, cutaneous malignant, susceptibility to, 2 | 2010-06-01 | no assertion criteria provided | literature only | |
Prevention |
RCV004754304 | SCV000805833 | likely pathogenic | CDKN2A-related disorder | 2024-08-27 | no assertion criteria provided | clinical testing | The CDKN2A c.9_32dup24 variant is predicted to result in an in-frame duplication (p.Ala4_Pro11dup). This variant was reported in multiple families with melanoma (Lang et al. 2005. PubMed ID: 16307646; Flores et al. 1997. PubMed ID: 9416844; Jovanovic et al. 2009. PubMed ID: 19759551; Bishop et al. 2002. PubMed ID: 12072543; Goldstein et al. 2006. PubMed ID: 16905682). In vitro experimental studies suggest this variant impacts protein function (Monzon et al. 1998. PubMed ID: 9516223; Becker et al. 2005. PubMed ID: 15945100). This variant is reported in 0.0057% of alleles in individuals of Latino descent in gnomAD. This variant is reported as likely pathogenic and pathogenic in ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/variation/135827/). This variant is interpreted as likely pathogenic. |