ClinVar Miner

Submissions for variant NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) (rs587780668)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 7
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV000122949 SCV000166207 likely pathogenic Hereditary melanoma 2018-07-05 criteria provided, single submitter clinical testing This sequence change inserts 24 nucleotides in exon 1 of the CDKN2A (p16INK4a) mRNA (c.9_32dup24). This leads to the insertion of 8 amino acid residues in the p16INK4a protein (p.Ala4_Pro11dup) but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (rs587780668, ExAC no frequency). This variant has been reported in the literature in several individuals affected with melanoma (PMID: 9516223, 16307646, 25803691), and has been shown to segregate with disease in several melanoma families, although with reduced penetrance (PMID: 9328469, 8595405, 16397522, 9416844). This variant is also known as 32_33ins9-32, 32ins24, and 23ins24 in the literature. ClinVar contains two entries for this variant (Variation ID: 135827, 12337007). An experimental study has shown that cells expressing this variant exhibit weaker cell-cycle inhibition in comparison to wild-type, and retain colony formation ability (PMID: 15945100). However, two other experimental studies have shown that this variant does not affect the binding of the p16INK4a protein to CDK4 or CDK6 (PMID: 8668202, 9516223). The clinical significance of these results is unclear. In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic.
GeneDx RCV000160401 SCV000210933 likely pathogenic not provided 2018-12-19 criteria provided, single submitter clinical testing This in-frame duplication of 24 nucleotides in CDKN2A is denoted c.9_32dup24 at the cDNA level and p.Ala4_Pro11dup (A4_P11dup) at the protein level. The normal sequence, with the bases that are duplicated in brackets, is AGCC[dup24]TTCG. A majority of this duplication is not located in a known functional domain; however, a single residue is located in the ANK1 repeat (UniProt). Although this variant has been demonstrated to behave similar to wild-type in in-vitro CDK4 binding assays (Parry 1996, Monzon 1998, Becker 2005), Monzon et al. suggested these assays might not be optimal in assessing function since this duplication is located outside of the motifs that are believed to play a role in CDK4 binding. In addition, Becker et al. (2005) demonstrated that CDKN2A c.9_32dup24 showed weak S-phase inhibition, decreased inhibition of pRb phosphorylation, and retained some colony formation ability in further assays. Additionally, this variant has been observed in multiple melanoma families, and CDKN2A c.9_32dup24 has been reported to segregate with disease (Walker 1995, Flores 1997, Harland 1997, Goldstein 2004, Lang 2005, Eliason 2006, Demenais 2010, Wadt 2015). Based on available evidence, we consider CDKN2A Ala4_Pro11dup to be a likely pathogenic variant. Of note, CDKN2A c.9_32dup24 has been reported in the literature using several alternate nomenclatures. Thus, when reviewing the papers cited above, it may be reported as any one of the following: 23ins24, 1_24dup, c.24_47dup24, c.32_33ins24, c.32_33ins9_32, 1_8dup8, p.Met1_Ser8dup, and p.M1_S8dup.
Ambry Genetics RCV000163609 SCV000214174 pathogenic Hereditary cancer-predisposing syndrome 2018-08-15 criteria provided, single submitter clinical testing The c.9_32dup24 pathogenic mutation (also known as p.A4_P11dup), located in coding exon 1 of the CDKN2A gene, results from an in-frame 24 nucleotide duplication between nucleotide positions 9 and 32. This results in the duplication of 8 extra amino acid residues between codons 4 and 11. This alteration has been shown to segregate with disease in multiple familial melanoma kindreds from several countries (Walker GJ et al. Hum. Mol. Genet. 1995 Oct;4:1845-52; Harland M et al. Hum. Mol. Genet. 1997 Nov;6:2061-7; Flores JF et al. Oncogene. 1997 Dec;15:2999-3005; Lang J et al. Br. J. Dermatol. 2005 Dec;153:1121-5; Eliason MJ et al. J. Invest. Dermatol. 2006 Mar;126:660-6). It has also been detected in a familial pancreatic cancer kindred as well as in individuals diagnosed with osteosarcoma, endometrial cancer, or colorectal cancer (Zhen DB et al. Genet. Med. 2015 Jul;17:569-77; Chan SH et al. Genomic Med. 2016;1; Pearlman R et al. JAMA Oncol. 2017 Apr 1;3(4):464-471). Several groups have performed in vitro assays to test for CDK4 binding and they have shown little impact on binding to CDK4 (Parry D and Peters G. Mol. Cell. Biol. 1996 Jul;16:3844-52; Monzon J et al. N. Engl. J. Med. 1998 Mar;38:879-87; Becker TM et al. Int. J. Cancer. 2005 Nov;117:569-73; McKenzie HA et al. Hum. Mutat. 2010 Jun;31:692-701). However, Becker et al. found this variant affects p16INK4a protein levels, its ability to inhibit S-phase when expressed at physiologic levels, and causes reduced phosphorylation of pRb, a downstream target. Of note, this alteration is also designated as 24 bp duplication/insertion, 23ins24, 32ins24, 32_33ins9-32, and p.M1_S8dup in published literature. Based on the available evidence, this alteration is classified as a pathogenic mutation.
Color Health, Inc RCV000163609 SCV000689617 likely pathogenic Hereditary cancer-predisposing syndrome 2020-06-08 criteria provided, single submitter clinical testing This variant causes an in-frame duplication of 8 amino acids in the CDKN2A (p16INK4A) protein. This variant is also known as c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3], 32_33ins9-32, 32ins24, and 23ins24. Functional studies have reported in vitro binding to CDK4 for the variant protein to be similar to the wild-type protein (PMID: 8668202, 9516223, 15945100). However, this variant protein was found to be partially defective in S-phase and cell proliferation inhibition and showed decreased inhibition of Retinoblastoma (RB) protein phosphorylation compared to the wild-type protein (PMID: 15945100). This variant has been reported in individuals affected with melanoma (PMID: 9516223, 16307646, 25803691) and also has been reported to segregate with disease in families, possibly with reduced penetrance (PMID: 8595405, 9328469, 9416844, 16397522). This variant has been identified in 3/265240 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of CDKN2A (p16INK4A) function is a known mechanism of disease. Based on the available evidence, this variant is classified as Likely Pathogenic.
PreventionGenetics,PreventionGenetics RCV000160401 SCV000805833 likely pathogenic not provided 2017-05-15 criteria provided, single submitter clinical testing
Women's Health and Genetics/Laboratory Corporation of America, LabCorp RCV000122949 SCV001362182 likely pathogenic Hereditary melanoma 2019-03-18 criteria provided, single submitter clinical testing Variant summary: CDKN2A c.9_32dup24 (p.Ala4_Pro11dup) results in an in-frame insertion of an additional copy of a 24 nucleotide repeat sequence that is naturally present in two copies at the 5' end of the CDKN2A gene; and is predicted to result in an insertion of 8 amino acids into the N-terminal end of the p16 (INK4A) protein. The variant allele was found at a frequency of 1.1e-05 in 262034 control chromosomes (gnomAD). c.9_32dup24 has been reported in the literature in multiple affected individuals with evidence of co-segregation with disease in affected families, however with reduced penetrance (Eliason_2006, Morzon_1998, Flores_1997, Harland_1997, Walker_1995). These data indicate that the variant is very likely to be associated with disease. One study providing experimental evidence for evaluation of an impact on protein function demonstrated diminished cell cycle-inhibitory activity which was associated with decreased inhibition of pRb phosphorylation, even though it effectively bound CDK4 (Becker_2005). However, two other studies found that the variant was fully active in mediating cell cycle arrest, showed wild-type subcellular localization and bound effectively to CDK4 and CDK6 (McKenzie_2010, Monzon_1998). Five ClinVar submissions from clinical diagnostic laboratories (evaluation after 2014) cite the variant as likely pathogenic (4x) and once as pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic.
OMIM RCV000010023 SCV000030244 risk factor Cutaneous malignant melanoma 2 2010-06-01 no assertion criteria provided literature only

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.