ClinVar Miner

Submissions for variant NM_000117.3(EMD):c.-161CAACGATTCGGCTGTGACGCGA[1]

dbSNP: rs1463296648
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 3
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
GeneDx RCV001586704 SCV001820529 likely benign not provided 2020-04-14 criteria provided, single submitter clinical testing This variant is associated with the following publications: (PMID: 9536090, 9195226)
Labcorp Genetics (formerly Invitae), Labcorp RCV002579450 SCV002966378 likely benign X-linked Emery-Dreifuss muscular dystrophy 2022-11-17 criteria provided, single submitter clinical testing
PreventionGenetics, part of Exact Sciences RCV003966234 SCV004779425 likely benign EMD-related disorder 2023-06-26 no assertion criteria provided clinical testing This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.