ClinVar Miner

Submissions for variant NM_000127.3(EXT1):c.1315_1337dup (p.Asn446_Lys447insHisValThrValTer)

dbSNP: rs1563571296
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Women's Health and Genetics/Laboratory Corporation of America, LabCorp RCV000781341 SCV000919306 likely pathogenic Multiple congenital exostosis 2018-06-13 criteria provided, single submitter clinical testing Variant summary: EXT1 c.1315_1337dupTCACGTAACAGTTTAATATGGAA (p.Lys447HisfsTer5) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as disease-causing in HGMD database (eg. c.2075G>A/p.W692*, c.2006delC/p.P669Qfs4). The variant was absent in 276534 control chromosomes. To our knowledge, no occurrence of c.1315_1337dupTCACGTAACAGTTTAATATGGAA in individuals affected with Multiple congenital exostosis and no experimental evidence demonstrating its impact on protein function have been reported. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as likely pathogenic.
Invitae RCV000781341 SCV002198590 pathogenic Multiple congenital exostosis 2021-09-21 criteria provided, single submitter clinical testing For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. ClinVar contains an entry for this variant (Variation ID: 633198). This variant has not been reported in the literature in individuals affected with EXT1-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Lys447Hisfs*5) in the EXT1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in EXT1 are known to be pathogenic (PMID: 10679937, 11391482, 19810120).

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.