ClinVar Miner

Submissions for variant NM_000143.3(FH):c.774_794dup (p.Thr260_Met266dup) (rs863223984)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
GeneDx RCV000199721 SCV000251449 likely pathogenic not provided 2014-07-21 criteria provided, single submitter clinical testing A likely disease-causing variant, c.774_794dupAATGACAAGAATAAAAGCTGC, has been identified in the FH gene. This variant has not been published as a mutation, nor has it been reported as a benign polymorphism to our knowledge. The c.774_794dupAATGACAAGAATAAAAGCTGC variant is an in-frame duplication of 7 amino acids and is not expected to result in protein truncation or nonsense-mediated mRNA decay. Five of the seven duplicated residues are highly conserved through mammals and are not within any known functional domain in the FH protein. Missense mutations within the duplicated residues (R261I) and in nearby residues (L244R, Q254R, A274P, A274T, G275E) have been reported in association with hereditary leiomyomatosis and renal cell cancer and fumarate hydratase deficiency, supporting the functional importance of this region of the protein. The c.774_794dupAATGACAAGAATAAAAGCTGC variant was not observed in approximately 6,500 samples from individuals of European and African American backgrounds in the NHLBI Exome Sequencing Project, indicating it is not a common benign variant in these populations. Therefore, c.774_794dupAATGACAAGAATAAAAGCTGC is a strong candidate for a disease-causing mutation, although the possibility that is a rare benign variant cannot be completely excluded. The variant is found in FH panel(s).

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.