ClinVar Miner

Submissions for variant NM_000179.2(MSH6):c.3922_3944dup (p.Lys1315fs) (rs1553333599)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Ambry Genetics RCV000491083 SCV000580342 pathogenic Hereditary cancer-predisposing syndrome 2016-04-28 criteria provided, single submitter clinical testing Lines of evidence used in support of classification: Alterations resulting in premature truncation (e.g.reading frame shift, nonsense)
Integrated Genetics/Laboratory Corporation of America RCV000588300 SCV000695896 likely pathogenic Lynch syndrome 2017-04-06 criteria provided, single submitter clinical testing Variant summary: The MSH6 c.3922_3944dupCTCCCAGAGGAAGTTATTCAAAA (p.Lys1315Asnfs) variant results in a premature termination codon, predicted to cause a truncated or absent MSH6 protein due to nonsense mediated decay, which are commonly known mechanisms for disease. This variant is located in the second to last exon (exon 9) of MSH6 that encodes the P-loop containing nucleoside triphosphate hydrolase of the protein (InterPro). Truncations downstream or at the region of this position have been classified as pathogenic by our laboratory and other labs/reputable databases in ClinVar (e.g. c.3938_3941dupTTCA, c.3939_3957dup, c.3959_3962delCAAG, etc.). This variant is absent in 119912 control chromosomes from ExAC. The variant of interest has not, to our knowledge, been reported in affected individuals via publications. A reputable database cites the variant with a classification of "Causal." Therefore, until additional information becomes available (ie, clinical and functional studies), the variant of interest has been classified as "likely pathogenic."

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.