ClinVar Miner

Submissions for variant NM_000179.2(MSH6):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT (rs878853743)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 3
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Color RCV000771151 SCV000902972 likely benign Hereditary cancer-predisposing syndrome 2015-11-17 criteria provided, single submitter clinical testing
GeneDx RCV000483099 SCV000572315 uncertain significance not specified 2016-11-21 criteria provided, single submitter clinical testing This variant is denoted MSH6 c.4001+11_4001+35del25 or IVS9+11_IVS9+35del25 and consists of a deletion of 25 nucleotides at the +11 to +35 position in intron 9 of the MSH6 gene. The surrounding sequence is aact[del25}gacc. MSH6 c.4001+11_4001+35del25 was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Variant Server, indicating it is not a common benign variant in these populations. This variant has been observed in an individual with a personal history of pancreatic cancer and a family history of breast cancer (Hu 2016). The nucleotides that are deleted are not conserved across species. In silico models are inconclusive with respect to splicing, and in the absence of RNA or functional studies, the actual effect of this variant is unknown. Based on the currently available information, we consider MSH6 c.4001+11_4001+35del25 to be a variant of uncertain significance.
Invitae RCV000228555 SCV000283831 likely benign Lynch syndrome 2016-01-02 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.