Total submissions: 3
| Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
|---|---|---|---|---|---|---|---|---|
| Ambry Genetics | RCV000491083 | SCV000580342 | pathogenic | Hereditary cancer-predisposing syndrome | 2016-04-28 | criteria provided, single submitter | clinical testing | The c.3922_3944dup23 variant, located in coding exon 9 of the MSH6 gene, results from a duplication of 23 nucleotides (CTCCCAGAGGAAGTTATTCAAAA) at nucleotide position 3922, causing a translational frameshift with a predicted alternate stop codon. Since frameshifts are typically deleterious in nature, this alteration is interpreted as a disease-causing mutation (ACMG Recommendations for Standards for Interpretation and Reporting of Sequence Variations. Revision 2007. Genet Med. 2008;10:294). |
| Women's Health and Genetics/Laboratory Corporation of America, |
RCV000588300 | SCV000695896 | likely pathogenic | Lynch syndrome | 2017-04-06 | criteria provided, single submitter | clinical testing | Variant summary: The MSH6 c.3922_3944dupCTCCCAGAGGAAGTTATTCAAAA (p.Lys1315Asnfs) variant results in a premature termination codon, predicted to cause a truncated or absent MSH6 protein due to nonsense mediated decay, which are commonly known mechanisms for disease. This variant is located in the second to last exon (exon 9) of MSH6 that encodes the P-loop containing nucleoside triphosphate hydrolase of the protein (InterPro). Truncations downstream or at the region of this position have been classified as pathogenic by our laboratory and other labs/reputable databases in ClinVar (e.g. c.3938_3941dupTTCA, c.3939_3957dup, c.3959_3962delCAAG, etc.). This variant is absent in 119912 control chromosomes from ExAC. The variant of interest has not, to our knowledge, been reported in affected individuals via publications. A reputable database cites the variant with a classification of "Causal." Therefore, until additional information becomes available (ie, clinical and functional studies), the variant of interest has been classified as "likely pathogenic." |
| Invitae | RCV001053878 | SCV001218161 | pathogenic | Hereditary nonpolyposis colorectal neoplasms | 2022-03-23 | criteria provided, single submitter | clinical testing | For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the MSH6 protein in which other variant(s) (p.Leu1330Valfs*12) have been determined to be pathogenic (PMID: 19851887, 21155762; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. ClinVar contains an entry for this variant (Variation ID: 428417). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Lys1315Asnfs*20) in the MSH6 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 46 amino acid(s) of the MSH6 protein. |