ClinVar Miner

Submissions for variant NM_000202.8(IDS):c.1436_1457dup (p.Ile487fs)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Pediatrics,All India Institute of Medical Sciences, New Delhi RCV001376069 SCV001572555 likely pathogenic Mucopolysaccharidosis, MPS-II 2014-01-01 no assertion criteria provided research The change c.1435_1456dupAAGCCGAGTTTAAAAGATATAA, (p.I487Afs*19) was found to be a novel small frame-shift duplication variant, where duplication of 22 nucleotides at position c.1435_1456 leads to frameshift change in the ORF of the translated peptide leading to substitution of an aliphatic nonpolar neutral amino acid Isoleucine at 487 position by aliphatic nonpolar neutral amino acid Alanine. This leads to change in peptide sequence and formation of a stop codon 19 amino acid downstream of the variant. It was detected in hemizygous state in one of the family with two sever phenotype MPS-II sibs, Indian origin.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.