Total submissions: 1
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Pediatrics, |
RCV001376069 | SCV001572555 | likely pathogenic | Mucopolysaccharidosis, MPS-II | 2014-01-01 | no assertion criteria provided | research | The change c.1435_1456dupAAGCCGAGTTTAAAAGATATAA, (p.I487Afs*19) was found to be a novel small frame-shift duplication variant, where duplication of 22 nucleotides at position c.1435_1456 leads to frameshift change in the ORF of the translated peptide leading to substitution of an aliphatic nonpolar neutral amino acid Isoleucine at 487 position by aliphatic nonpolar neutral amino acid Alanine. This leads to change in peptide sequence and formation of a stop codon 19 amino acid downstream of the variant. It was detected in hemizygous state in one of the family with two sever phenotype MPS-II sibs, Indian origin. |