Total submissions: 1
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Invitae | RCV000198392 | SCV000253783 | pathogenic | Long QT syndrome | 2015-02-18 | criteria provided, single submitter | clinical testing | For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, truncating variants in KCNH2 are known to be pathogenic (PMID: 10973849, 17576861). This sequence change inserts 29 nucleotide in exon 4 of the KCNH2 mRNA (c.473_501dupGCCGCGCCAAGACCTTCCGCCTGAAGCTG), causing a frameshift at codon 168. This creates a premature translational stop signal (p.Pro168Alafs*8) and is expected to result in an absent or disrupted protein product. |