Total submissions: 2
| Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
|---|---|---|---|---|---|---|---|---|
| Labcorp Genetics |
RCV002233195 | SCV000817313 | uncertain significance | Renal cell carcinoma | 2018-05-22 | criteria provided, single submitter | clinical testing | This variant, c.-12_17del, results in the deletion that affects the initiator methionine of the MET mRNA. The next in-frame methionine is located at codon 35. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with MET-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in MET cause disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. |
| Ambry Genetics | RCV004026333 | SCV004902700 | uncertain significance | Hereditary cancer-predisposing syndrome | 2021-01-06 | criteria provided, single submitter | clinical testing | The c.-12_17del29 (p.M1?) alteration is located in coding exon 1 of the MET gene and consists of a AAACCTCTCATAATGAAGGCCCCCGCTGT to ----------------------------- substitution at nucleotide position 1. This changes the amino acid from a methionine to a (?) at the initiation codon. Sequence variations that modify the initiation codon (ATG) are expected to cause a shift in the mRNA reading frame and are typically deleterious in nature (Richards, 2015). Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. |