Total submissions: 2
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Ambry Genetics | RCV001010466 | SCV001170668 | pathogenic | Hereditary cancer-predisposing syndrome | 2021-08-09 | criteria provided, single submitter | clinical testing | The c.1233_1254dup22 variant, located in coding exon 12 of the MLH1 gene, results from a duplication of TGTCACAGAGGATAAGACAGAT at nucleotide position 1233, causing a translational frameshift with a predicted alternate stop codon (p.I419Cfs*5). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. |
Myriad Genetics, |
RCV003455069 | SCV004188892 | pathogenic | Colorectal cancer, hereditary nonpolyposis, type 2 | 2023-07-19 | criteria provided, single submitter | clinical testing | This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. |