ClinVar Miner

Submissions for variant NM_000249.4(MLH1):c.1840_1870dup (p.Asp624delinsValSerGluGluGluGlyTer)

dbSNP: rs2085310643
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV001046404 SCV001210306 pathogenic Hereditary nonpolyposis colorectal neoplasms 2020-01-16 criteria provided, single submitter clinical testing For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). This variant has not been reported in the literature in individuals with MLH1-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Asp624Valfs*7) in the MLH1 gene. It is expected to result in an absent or disrupted protein product.
Ambry Genetics RCV002409412 SCV002715084 pathogenic Hereditary cancer-predisposing syndrome 2018-06-25 criteria provided, single submitter clinical testing The c.1840_1870dup31 variant, located in coding exon 16 of the MLH1 gene, results from a duplication of TTTCTGAAGAAGAAGGCTGAGATGCTTGCAG at nucleotide position 1840, causing a translational frameshift with a predicted alternate stop codon (p.D624Vfs*7). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.