Total submissions: 2
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Invitae | RCV001046404 | SCV001210306 | pathogenic | Hereditary nonpolyposis colorectal neoplasms | 2020-01-16 | criteria provided, single submitter | clinical testing | For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). This variant has not been reported in the literature in individuals with MLH1-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Asp624Valfs*7) in the MLH1 gene. It is expected to result in an absent or disrupted protein product. |
Ambry Genetics | RCV002409412 | SCV002715084 | pathogenic | Hereditary cancer-predisposing syndrome | 2018-06-25 | criteria provided, single submitter | clinical testing | The c.1840_1870dup31 variant, located in coding exon 16 of the MLH1 gene, results from a duplication of TTTCTGAAGAAGAAGGCTGAGATGCTTGCAG at nucleotide position 1840, causing a translational frameshift with a predicted alternate stop codon (p.D624Vfs*7). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. |