ClinVar Miner

Submissions for variant NM_000249.4(MLH1):c.706_725del (p.Lys236fs)

dbSNP: rs863224480
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Labcorp Genetics (formerly Invitae), Labcorp RCV000195440 SCV000253793 pathogenic Lynch syndrome 2015-06-13 criteria provided, single submitter clinical testing This sequence change deletes 20 nucleotides in exon 9 of the MLH1 mRNA (c.704_723delATAAAACCCTAGCCTTCAAA), causing a frameshift at codon 236. This creates a premature translational stop signal (p.Lys236Glufs*64) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). For these reasons, this variant has been classified as Pathogenic.
Labcorp Genetics (formerly Invitae), Labcorp RCV001215259 SCV001386993 pathogenic Hereditary nonpolyposis colorectal neoplasms 2019-08-15 criteria provided, single submitter clinical testing This sequence change creates a premature translational stop signal (p.Lys236Glufs*64) in the MLH1 gene. It is expected to result in an absent or disrupted protein product. This variant has not been reported in the literature in individuals with MLH1-related conditions. Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). For these reasons, this variant has been classified as Pathogenic.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.