ClinVar Miner

Submissions for variant NM_000251.2(MSH2):c.1662-12_1677del (rs864622436)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV000204865 SCV000260638 likely pathogenic Lynch syndrome 2016-10-26 criteria provided, single submitter clinical testing This sequence change deletes the last 12 nucleotides in intron 10 and the first 16 nucleotides in exon 11 of the MSH2 mRNA (c.1662-12_1677delTTCGATTTGCAGCAAATTGACTTCTTTA). It is expected to disrupt mRNA splicing and likely results in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). The region deleted by this variant includes the acceptor splice site in intron 10 of the MSH2 gene, which could result in the out-of-frame skipping of exon 11. However, this prediction has not been confirmed by published transcriptional studies. For these reasons, this variant has been classified as Likely Pathogenic.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.