Total submissions: 1
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Ambry Genetics | RCV002349806 | SCV002648165 | pathogenic | Hereditary cancer-predisposing syndrome | 2021-07-04 | criteria provided, single submitter | clinical testing | The c.1202_1255del54 pathogenic mutation (also known as p.L401*) is located in coding exon 7 of the MSH2 gene. This pathogenic mutation results from an in-frame TACAAGATTGTTACCGACTCTATCAGGGTATAAATCAACTACCTAATGTTATAC deletion at nucleotide positions 1202 to 1255. This results in an immediate stop codon at amino acid position 401. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. |