ClinVar Miner

Submissions for variant NM_000251.3(MSH2):c.393_435dup (p.Gly146Ter)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Ambry Genetics RCV002373222 SCV002624249 pathogenic Hereditary cancer-predisposing syndrome 2019-07-22 criteria provided, single submitter clinical testing The c.393_435dup43 variant, located in coding exon 3 of the MSH2 gene, results from a duplication of TGAAGACATTCTCTTTGGTAACAATGATATGTCAGCTTCCATT at nucleotide position 393, causing a translational frameshift with a predicted alternate stop codon (p.G146*). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.