Total submissions: 3
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
International Society for Gastrointestinal Hereditary Tumours |
RCV000076622 | SCV000107657 | pathogenic | Lynch syndrome | 2013-09-05 | reviewed by expert panel | research | Coding sequence variation resulting in a stop codon |
Ambry Genetics | RCV002336227 | SCV002644659 | pathogenic | Hereditary cancer-predisposing syndrome | 2022-10-17 | criteria provided, single submitter | clinical testing | The c.511_583dup73 pathogenic mutation, located in coding exon 3 of the MSH2 gene, results from a duplication of AGGAAACTAGGACTGTGTGAATTCCCTGATAATGATCAGTTCTCCAATCTTGAGGCTCTCCTCATCCAGATTG at nucleotide position 511, causing a translational frameshift with a predicted alternate stop codon (p.G195Efs*7). In a study of 1,721 German probands suspected of HNPCC, this mutation was detected in two families (Mangold E et al. Int. J. Cancer, 2005 Sep;116:692-702). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. |
Myriad Genetics, |
RCV003452946 | SCV004186978 | pathogenic | Lynch syndrome 1 | 2023-07-27 | criteria provided, single submitter | clinical testing | This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. |