ClinVar Miner

Submissions for variant NM_000251.3(MSH2):c.511_583dup (p.Gly195delinsGluGluThrArgThrValTer)

dbSNP: rs1553350789
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 3
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
International Society for Gastrointestinal Hereditary Tumours (InSiGHT) RCV000076622 SCV000107657 pathogenic Lynch syndrome 2013-09-05 reviewed by expert panel research Coding sequence variation resulting in a stop codon
Ambry Genetics RCV002336227 SCV002644659 pathogenic Hereditary cancer-predisposing syndrome 2022-10-17 criteria provided, single submitter clinical testing The c.511_583dup73 pathogenic mutation, located in coding exon 3 of the MSH2 gene, results from a duplication of AGGAAACTAGGACTGTGTGAATTCCCTGATAATGATCAGTTCTCCAATCTTGAGGCTCTCCTCATCCAGATTG at nucleotide position 511, causing a translational frameshift with a predicted alternate stop codon (p.G195Efs*7). In a study of 1,721 German probands suspected of HNPCC, this mutation was detected in two families (Mangold E et al. Int. J. Cancer, 2005 Sep;116:692-702). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
Myriad Genetics, Inc. RCV003452946 SCV004186978 pathogenic Lynch syndrome 1 2023-07-27 criteria provided, single submitter clinical testing This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.