ClinVar Miner

Submissions for variant NM_000260.3(MYO7A):c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG (rs111033223)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 6
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
ClinGen Hearing Loss Variant Curation Expert Panel, RCV000710330 SCV000840521 benign Nonsyndromic hearing loss and deafness 2018-09-28 reviewed by expert panel curation The filtering allele frequency of the c.3503+12_3503+33del (p.Gly1172GlufsX34) variant in the MYO7A gene is 50.8% (11084/21494) of European (Finnish) chromosomes by the Genome Aggregation Database (http://gnomad.broadinstitute.org; calculated by using inverse allele frequency at https://www.cardiodb.org/allelefrequencyapp/), which is a high enough frequency to be classified as benign based on thresholds defined by the ClinGen Hearing Loss Expert Panel for autosomal recessive hearing loss variants (BA1).
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine RCV000036111 SCV000060586 benign not specified 2012-11-05 criteria provided, single submitter clinical testing See NM_000260 c.3503+12_3503+33del
PreventionGenetics,PreventionGenetics RCV000036111 SCV000303292 benign not specified criteria provided, single submitter clinical testing
EGL Genetic Diagnostics,Eurofins Clinical Diagnostics RCV000036111 SCV000331525 benign not specified 2015-09-19 criteria provided, single submitter clinical testing
GeneDx RCV000036111 SCV000729224 benign not specified 2013-01-14 criteria provided, single submitter clinical testing This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease.
Mendelics RCV000988608 SCV001138387 benign Deafness, autosomal recessive 2 2019-05-28 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.