ClinVar Miner

Submissions for variant NM_000314.4:c.-(1087_1062)delGCTCGCACCCAGAGCTACCGCTCTGC

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
GeneDx RCV000115551 SCV000149460 uncertain significance Hereditary cancer-predisposing syndrome 2013-12-31 criteria provided, single submitter clinical testing Deletion of 26 nucleotides in the PTEN promoter region; Not been published as a mutation or a benign polymorphism. This variant is found in BR-OV-HEREDIC panel(s).

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.