ClinVar Miner

Submissions for variant NM_000321.2(RB1):c.1421+12_1421+32delACTTTTAGTAAAAAATTTTTT (rs587781256)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Integrated Genetics/Laboratory Corporation of America RCV000587801 SCV000696566 likely pathogenic Hereditary cancer-predisposing syndrome 2017-01-24 criteria provided, single submitter clinical testing Variant summary: The RB1 c.1421+12_1421+32delACTTTTAGTAAAAAATTTTTT variant leads to deletion of 21 nucleotides in intron 15. Mutation Taster predicts a disease-causing outcome for this variant. 4/5 splice prediction tools predict creation of a cryptic splice acceptor site. This variant is absent in 23000 control chromosomes from ExAC. Intron 15 of this gene is particularly noted for its small size and presence of many variants in this intron that are known to affect splicing and cause disease (e.g. c.1412_1421+14del, c.1420_1421+28del, c.1420_1421+30del, c.1421+3_1421+23del, c.1421+3_1421+30del, c.1421+18_1421+32del15, c.1421+18_1421+33del16, c.1421+18_1421+38del, c.1421+20_1421+33del, etc. Ref. LOVD). The variant of interest, c.1421+12_1421+32del, has been reported from a study in one patient with retinoblastoma (Liu_1995). Another study (Whitworth_2015) also reports this variant in patient series with multiple primary malignant tumours, however, specific phenotype and number of occurrences are not provided. One clinical diagnostic laboratory has classified this variant as pathogenic. Taken together, this variant is classified as likely pathogenic.
Medical Molecular Genetics,University of Birmingham RCV000128456 SCV000172157 pathogenic Retinoblastoma 2008-12-01 no assertion criteria provided clinical testing Clinically treated as causative

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.