ClinVar Miner

Submissions for variant NM_000391.4(TPP1):c.457_490del (p.Ser153fs) (rs878855331)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics RCV000234817 SCV000292000 likely pathogenic Ceroid lipofuscinosis neuronal 2 2016-01-19 no assertion criteria provided research Variant c.457_490delTCCCCACATCCCTACCAGCTTCCACAGGCCTTGG (ENST00000299427) found to be pathogenic by online software Mutation Taster

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.