Total submissions: 2
| Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
|---|---|---|---|---|---|---|---|---|
| Clin |
RCV000508828 | SCV002817159 | uncertain significance | Hypercholesterolemia, familial, 1 | 2022-10-28 | reviewed by expert panel | curation | The NM_000527.5 (LDLR):c.1187G>A (p.Gly396Asp) variant is classified as Uncertain significance - insufficient evidence for Familial Hypercholesterolemia by applying evidence code (PM2) as defined by the ClinGen Familial Hypercholesterolemia Expert Panel LDLR-specific variant curation guidelines (https://doi.org/10.1016/j.gim.2021.09.012). The supporting evidence is as follows: PM2: This variant is absent from gnomAD (gnomAD version 2.1.1). PP3/BP4 not met: REVEL=0.566, it is not above 0.75 but between 0.5-0.75, splicing evaluation required. Functional data on splicing is not available. In scenario A, acceptor site: The variant is located at -20 to +3 bases of canonical acceptor splicing site of exon 9. Wild type canonical acceptor motif: CTCGCTCCCCGGACCCCCAGGCT, MES: 6.59; Variant canonical acceptor motif: CTCGCTCCCCGGACCCCCAGACT, MES: 6.16. Var/Wt ratio = 0.93, greater than 0.8 and less than 1.0. Alternative splicing is not predicted. PS3 not met: Functional data not available. PP4, PS4 not met: Variant meets PM2, however clinical data is not available. PM5 not met: Three other missense variants in the same codon: NM_000527.5 (LDLR):c.1186G>A (p.Gly396Ser), (ClinVarID 251704), NM_000527.5 (LDLR):c.1187G>T (p.Gly396Val), (ClinVarID 924165), NM_000527.5 (LDLR):c.1186G>C (p.Gly396Arg), (ClinVarID 870321). None is classified as Pathogenic by these guidelines, therefore PM5 is not met. |
| Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde, |
RCV000508828 | SCV000606347 | pathogenic | Hypercholesterolemia, familial, 1 | no assertion criteria provided | research |