ClinVar Miner

Submissions for variant NM_000527.5(LDLR):c.1309_1310insTCGCTCTGGACACGTAGGTGG (p.Ala437delinsValAlaLeuAspThrTer)

dbSNP: rs2077410686
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Brunham Lab, Centre for Heart and Lung Innovation, University of British Columbia RCV001255945 SCV001432626 pathogenic Hypercholesterolemia, familial, 1 2019-01-15 criteria provided, single submitter research
Ambry Genetics RCV002379959 SCV002694290 pathogenic Cardiovascular phenotype 2017-09-14 criteria provided, single submitter clinical testing The c.1309_1310ins21 pathogenic mutation, located in coding exon 9 of the LDLR gene, results from an in-frame insertion of 21 nucleotides between nucleotide positions 1309 to 1310 (TCGCTCTGGACACGTAGGTGG). This results in the insertion of five extra residues followed by a stop signal between codons 436 and 437 (p.V436_A437insVALDT*). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.