Total submissions: 2
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Brunham Lab, |
RCV001255945 | SCV001432626 | pathogenic | Hypercholesterolemia, familial, 1 | 2019-01-15 | criteria provided, single submitter | research | |
Ambry Genetics | RCV002379959 | SCV002694290 | pathogenic | Cardiovascular phenotype | 2017-09-14 | criteria provided, single submitter | clinical testing | The c.1309_1310ins21 pathogenic mutation, located in coding exon 9 of the LDLR gene, results from an in-frame insertion of 21 nucleotides between nucleotide positions 1309 to 1310 (TCGCTCTGGACACGTAGGTGG). This results in the insertion of five extra residues followed by a stop signal between codons 436 and 437 (p.V436_A437insVALDT*). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. |