Submissions for variant NM_000527.5(LDLR):c.257_265del (p.Phe86_Arg88del)

dbSNP: rs879254451

Total submissions: 5

Submitter	RCV	SCV	Clinical significance	Condition	Last evaluated	Review status	Method	Comment
ClinGen Familial Hypercholesterolemia Variant Curation Expert Panel	RCV000237667	SCV002817127	uncertain significance	Hypercholesterolemia, familial, 1	2022-08-29	reviewed by expert panel	curation	The NM_000527.5(LDLR):c.257_265del (p.Phe86_Arg88del) variant is classified as Uncertain significance - insufficient evidence for Familial Hypercholesterolemia by applying evidence code PM2, PM4, BP4 and PP4 as defined by the ClinGen Familial Hypercholesterolemia Expert Panel LDLR-specific variant curation guidelines (https://doi.org/10.1016/j.gim.2021.09.012). The supporting evidence is as follows: PM2 - This variant is absent from gnomAD (gnomAD v2.1.1). PM4 - Variant meets PM2 and is in frame deletion. BP4 - No REVEL, splicing is needed: A - not on limits. B - not on limits C - There are 2 AG sites nearby: 1- Wild type canonical acceptor: CAATCCTGTCTCTTCTGTAGTGT: 7.07 Wild type cryptic acceptor: CAACCGCTGCATTCCTCAGTTCT: -15.64 Variant cryptic acceptor: CAACCGCTGCATTCCTCAGTGCG: -13.6 cryptic sites have negative scores, so they are not used 2- > Wild type canonical acceptor: CAATCCTGTCTCTTCTGTAGTGT: 7.07 Wild type cryptic acceptor: CTGGAGGTGCGATGGCCAAGTGG: -7.59 Variant cryptic acceptor: TCCTCAGTGCGATGGCCAAGTGG: -4.74 cryptic sites have negative scores, so they are not used There is a GT site nearby: Wild type canonical acceptor: GTCGTAAGT: 9.9 Wild type cryptic acceptor: CAGTTCTGG: -3.44 Variant cryptic acceptor: CAGTGCGAT: -14.44 cryptic sites have negative scores, so they are not used The variant does not affect splicing, so BP4 is met.. PP4 - Variant meets PM2 and is identified in one index case from PMID 11462246.
LDLR-LOVD, British Heart Foundation	RCV000237667	SCV000294559	likely pathogenic	Hypercholesterolemia, familial, 1	2016-03-25	criteria provided, single submitter	literature only
GeneDx	RCV000481990	SCV000568519	likely pathogenic	not provided	2016-11-21	criteria provided, single submitter	clinical testing	The c.257_265delTCTGGAGGT likely pathogenic variant (also described as F65_R67del due to alternate nomenclature) in the LDLR gene has been reported previously in at least one German individual with a diagnosis of FH (Geisel et al., 1998; Nauck et al., 2001). This variant was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project or in the Exome Aggregation Consortium, indicating it is not a common benign variant in these populations. Although the c.257_265delTCTGGAGGT variant causes the in-frame deletion of three amino acids which does not result in protein truncation, a missense variant at residue Tryptophan 87 has been shown to result in binding defective protein (Leitersdorf et al., 1990). However, in the absence of functional mRNA studies, the physiological consequence of this variant cannot be precisely determined.Therefore, this variant is likely pathogenic. In order to definitively determine its clinical significance, additional data is required.
Labcorp Genetics (formerly Invitae), Labcorp	RCV000791390	SCV000818131	pathogenic	Familial hypercholesterolemia	2024-09-15	criteria provided, single submitter	clinical testing	This variant, c.257_265del, results in the deletion of 3 amino acid(s) of the LDLR protein (p.Phe86_Arg88del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with familial hypercholesterolemia (PMID: 9676383, 11462246; internal data). This variant is also known as delF65-R67. ClinVar contains an entry for this variant (Variation ID: 251097). This variant disrupts a region of the LDLR protein in which other variant(s) (p.Trp87Gly) have been determined to be pathogenic (PMID: 2318961, 8098448, 12553167, 16542394). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic.
Ambry Genetics	RCV002429166	SCV002741715	likely pathogenic	Cardiovascular phenotype	2021-11-20	criteria provided, single submitter	clinical testing	The c.257_265delTCTGGAGGT variant (also known as p.F86_R88del) is located in coding exon 3 of the LDLR gene. This variant results from an in-frame TCTGGAGGT deletion at nucleotide positions 257 to 265. This results in the in-frame deletion of phenylalanine, tryptophan, and arginine at codon 86. This alteration (also known as delF65-R67) has been reported in individuals with familial hypercholesterolemia (FH) (Ambry internal data; Nauck MS et al. Hum. Mutat., 2001 Aug;18:165-6; Villéger L et al. Hum. Mutat., 2002 Aug;20:81-7). Based on internal structural analysis, this variant is anticipated to result in a significant decrease in structural stability (Kurniawan ND et al. Protein Sci., 2000 Jul;9:1282-93). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). The amino acid positions range from poorly conserved to highly conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the majority of available evidence to date, this variant is likely to be pathogenic.