Submissions for variant NM_000527.5(LDLR):c.663_683dup (p.Asp221_Asp227dup)

dbSNP: rs879254620

Total submissions: 7

Submitter	RCV	SCV	Clinical significance	Condition	Last evaluated	Review status	Method	Comment
LDLR-LOVD, British Heart Foundation	RCV000238041	SCV000294864	likely pathogenic	Hypercholesterolemia, familial, 1	2016-03-25	criteria provided, single submitter	literature only
Invitae	RCV000586459	SCV000544677	pathogenic	Familial hypercholesterolemia	2024-01-08	criteria provided, single submitter	clinical testing	This variant, c.663_683dup, results in the insertion of 7 amino acid(s) of the LDLR protein (p.Asp221_Asp227dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with familial hypercholesterolemia and homozygous familial hypercholesterolemia (PMID: 1301956, 8599353, 9026534, 10447263, 16250003; Invitae). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 251358). For these reasons, this variant has been classified as Pathogenic.
Fundacion Hipercolesterolemia Familiar	RCV000238041	SCV000607483	likely pathogenic	Hypercholesterolemia, familial, 1	2016-03-01	criteria provided, single submitter	research
Women's Health and Genetics/Laboratory Corporation of America, LabCorp	RCV000586459	SCV000697246	pathogenic	Familial hypercholesterolemia	2017-10-23	criteria provided, single submitter	clinical testing	Variant Summary: The c.663_683dupCTGCAAGGACAAATCTGACGA (p.Asp221_Asp227dup) variant is an in-frame duplication of 21 nucleotides and results in the in-frame duplication of 7 codons in a non-repetitive region. Mutation taster predicts benign outcome for this variant. This variant is absent in 275344 control chromosomes (gnomAD). It has been reported in several individuals in the literature with either definite homozygous FH along with a second pathogenic LDLR variant or heterozygous FH. In three publications, patients with homozygous FH were shown to have <2% LDL-r activity (Webb_1996, Hobbs_1992, Blackett_1995). In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic/likely pathogenic. Other similar variants have been reported in association with FH in database (HGMD). Taken together, this variant is classified as pathogenic.
Ambry Genetics	RCV002365241	SCV002661892	pathogenic	Cardiovascular phenotype	2022-03-24	criteria provided, single submitter	clinical testing	The c.663_683dup21 pathogenic mutation (also known as p.D221_D227dup), located in coding exon 4 of the LDLR gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 663 to 683. This results in the duplication of seven residues (DCKDKSD) between amino acids 221 and 227. This variant, also known as FH Tulsa-1, has been detected in individuals with homozygous familial hypercholesterolemia (FH), who had a second variant in LDLR and attenuated LDLR activity in fibroblasts (Hobbs HH et al. Hum Mutat. 1992;1:445-66; Webb JC et al. J Lipid Res. 1996;37:368-81; Blackett PR, Am. J. Med. Genet. 1995 Nov;59(3):300-3). This variant was reported to segregate with FH in the mother and maternal grandmother of one proband (Webb JC et al. J Lipid Res. 1996;37:368-81). In addition, this variant has been identified in cohorts of FH patients from various ethnic groups and additional individuals with LDL-C levels consistent with FH (Hattori H et al. Hum Mutat. 1999;14:87; Fouchier SW et al. Hum Mutat. 2005;26:550-6; Ambry internal data). This alteration impacts residues in the conserved cluster of acidic amino acids at the C-terminal end of LDLR class A repeat 5 (Jeon H and Blacklow C. Annu. Rev. Biochem. 2005;74:535-62). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation.
GeneDx	RCV003327389	SCV004034458	likely pathogenic	not provided	2023-09-06	criteria provided, single submitter	clinical testing	Not observed at significant frequency in large population cohorts (gnomAD); In-frame insertion of 7 amino acids in a non-repeat region; Also known as FH Tulsa-1 and p.D200_D206dup due to alternate nomenclature; This variant is associated with the following publications: (PMID: 15241806, 1301956, 8599353, 16250003, 17094996, 10447263, 9026534)
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde, Academisch Medisch Centrum	RCV000238041	SCV000606184	pathogenic	Hypercholesterolemia, familial, 1		no assertion criteria provided	research