ClinVar Miner

Submissions for variant NM_000527.5(LDLR):c.663_683dup (p.Asp221_Asp227dup) (rs879254620)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 5
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
LDLR-LOVD, British Heart Foundation RCV000238041 SCV000294864 likely pathogenic Familial hypercholesterolemia 1 2016-03-25 criteria provided, single submitter literature only
Invitae RCV000586459 SCV000544677 pathogenic Familial hypercholesterolemia 2020-03-16 criteria provided, single submitter clinical testing This variant, c.663_683dupCTGCAAGGACAAATCTGACGA, results in the insertion of 7 amino acids to the LDLR protein (p.Asp221_Asp227dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has been reported in multiple individuals affected with familial hypercholesterolemia (PMID: 9026534, 10447263, 16250003, Invitae database). It has also been reported in several individuals with homozygous familial hypercholesterolemia (PMID: 8599353, 9026534, 1301956). In at least one individual the data is consistent with the variant being in trans (on the opposite chromosome) from a pathogenic variant. This variant is alternatively known as p.200-206dup, c.681_701dup, and Tulsa-1 in the literature. ClinVar contains an entry for this variant (Variation ID: 251358). For these reasons, this variant has been classified as Pathogenic.
Fundacion Hipercolesterolemia Familiar RCV000238041 SCV000607483 likely pathogenic Familial hypercholesterolemia 1 2016-03-01 criteria provided, single submitter research
Women's Health and Genetics/Laboratory Corporation of America, LabCorp RCV000586459 SCV000697246 pathogenic Familial hypercholesterolemia 2017-10-23 criteria provided, single submitter clinical testing Variant Summary: The c.663_683dupCTGCAAGGACAAATCTGACGA (p.Asp221_Asp227dup) variant is an in-frame duplication of 21 nucleotides and results in the in-frame duplication of 7 codons in a non-repetitive region. Mutation taster predicts benign outcome for this variant. This variant is absent in 275344 control chromosomes (gnomAD). It has been reported in several individuals in the literature with either definite homozygous FH along with a second pathogenic LDLR variant or heterozygous FH. In three publications, patients with homozygous FH were shown to have <2% LDL-r activity (Webb_1996, Hobbs_1992, Blackett_1995). In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic/likely pathogenic. Other similar variants have been reported in association with FH in database (HGMD). Taken together, this variant is classified as pathogenic.
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum RCV000238041 SCV000606184 pathogenic Familial hypercholesterolemia 1 no assertion criteria provided research

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.