ClinVar Miner

Submissions for variant NM_000540.2(RYR1):c.13331_13351dup (p.Gly4444_Gly4450dup) (rs1358102336)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Integrated Genetics/Laboratory Corporation of America RCV000780690 SCV000918161 uncertain significance not specified 2017-12-06 criteria provided, single submitter clinical testing Variant summary: Variant RYR1 c.13331_13351dupGCCCCTTCCGGCCCGAAGGGG (p.G4444_G4450dup) is an in-frame duplication located within the ryanodine receptor TM 4-6 domain of RYR1 (InterPro). One in silico tools predicts the variant to be a polymorphism (MutationTaster). The variant was not found in 60156 control chromosomes in gnomAD. However, the variant 19:39056300 T / TGGGGGCCCCTTCCGGCCCGAA which gives the same codon change has 4 occurrence in gnomAD, and was exclusive to the European (Non-Finnish) subpopulation at a frequency of 0.000176 (4/22730). This frequency is approximately 3 times higher than the maximal expected allele frequency of a pathogenic variant in RYR1, suggesting possibly benign outcome for the codon change of p.G4444_G4450dup, especially in the European (Non-Finnish) subpopulation. The majority of central core disease-causing RYR1 variants are missense mutations located in the C-terminus domain, which includes amino acids 4450-4940 (PMCID:PMC1887524), and variant of interest is not located in that region. This particular variant has not been cited in the literature or publically available disease databases. Taken together, due to lack of clinical and functional information, this variant is classified as VUS.
Invitae RCV000549587 SCV000659812 uncertain significance RYR1-Related Disorders 2018-09-25 criteria provided, single submitter clinical testing This variant, c.13331_13351dup, results in the insertion of 7 amino acids to the RYR1 protein (p.Gly4444_Gly4450dup), but otherwise preserves the integrity of the reading frame. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals with RYR1-related disease. ClinVar contains an entry for this variant (Variation ID: 478183). Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the duplicated amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.