Submissions for variant NM_000546.6(TP53):c.234_263del (p.Ala79_Ala88del)

dbSNP: rs754312472

Total submissions: 9

Submitter	RCV	SCV	Clinical significance	Condition	Last evaluated	Review status	Method	Comment
Invitae	RCV000531064	SCV000629795	uncertain significance	Li-Fraumeni syndrome	2023-11-04	criteria provided, single submitter	clinical testing	This variant, c.234_263del, results in the deletion of 10 amino acid(s) of the TP53 protein (p.Ala79_Ala88del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs754312472, gnomAD 0.03%). This variant has been observed in individual(s) with breast cancer (PMID: 31119730). ClinVar contains an entry for this variant (Variation ID: 458529). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. RNA analysis performed to evaluate the impact of this variant on mRNA splicing indicates it does not significantly alter splicing (Invitae). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Ambry Genetics	RCV000567464	SCV000676300	uncertain significance	Hereditary cancer-predisposing syndrome	2024-02-23	criteria provided, single submitter	clinical testing	The c.234_263del30 variant (also known as p.A79_A88del) is located in coding exon 3 of the TP53 gene. This variant results from an in-frame AGCTCCTACACCGGCGGCCCCTGCACCAGC deletion at nucleotide positions 234 to 263. This results in the in-frame deletion of 10 amino acids (APTPAAPAPA) at positions 79 to 88. In addition, the in silico prediction for this alteration is inconclusive (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
Mendelics	RCV000531064	SCV000839126	uncertain significance	Li-Fraumeni syndrome	2018-07-02	criteria provided, single submitter	clinical testing
Color Diagnostics, LLC DBA Color Health	RCV000567464	SCV001340450	uncertain significance	Hereditary cancer-predisposing syndrome	2021-03-05	criteria provided, single submitter	clinical testing	This variant results in an in-frame deletion of 10 amino acids in the Proline-rich domain of the TP53 protein. This variant is also known as p.78_88del in the literature. To our knowledge, functional studies have not been reported for this variant. This variant has been observed in two individuals affected with breast cancer (PMID: 31119730). This variant also has been identified in 6/250382 chromosomes (6/18390 East Asian chromosomes) in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance.
GeneDx	RCV001553020	SCV001773815	uncertain significance	not provided	2021-05-05	criteria provided, single submitter	clinical testing	In-frame deletion of 10 amino acids in a non-repeat region; Not observed at a significant frequency in large population cohorts (Lek et al., 2016); In silico analysis supports a deleterious effect on protein structure/function; Located in the SH3 domain (Bode 2004); Has not been previously published as pathogenic or benign to our knowledge
Sema4, Sema4	RCV000567464	SCV002530436	uncertain significance	Hereditary cancer-predisposing syndrome	2021-09-13	criteria provided, single submitter	curation
MGZ Medical Genetics Center	RCV002289724	SCV002580492	uncertain significance	Li-Fraumeni syndrome 1	2021-11-09	criteria provided, single submitter	clinical testing
Genome-Nilou Lab	RCV000567464	SCV002582132	uncertain significance	Hereditary cancer-predisposing syndrome	2022-06-18	criteria provided, single submitter	clinical testing
Genome-Nilou Lab	RCV002289724	SCV002582694	uncertain significance	Li-Fraumeni syndrome 1	2022-06-18	criteria provided, single submitter	clinical testing