ClinVar Miner

Submissions for variant NM_000969.5(RPL5):c.619_620insTGTACATCGGAAGCACATCATGGGCCAGAATGTTGCAGATT (p.Tyr207fs)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Ambry Genetics RCV002353824 SCV002657363 pathogenic Diamond-Blackfan anemia 2021-02-19 criteria provided, single submitter clinical testing The c.619_620ins41 variant, located in coding exon 6 of the RPL5 gene, results from an insertion of 41 nucleotides (TGTACATCGGAAGCACATCATGGGCCAGAATGTTGCAGATT) at position 619, causing a translational frameshift with a predicted alternate stop codon (p.Y207Lfs*19). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.