ClinVar Miner

Submissions for variant NM_001199107.2(TBC1D24):c.1206+20CCAGGGCTGGCTCTGATGGGCT[2]

dbSNP: rs777798547
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Labcorp Genetics (formerly Invitae), Labcorp RCV002136836 SCV002404540 benign Developmental and epileptic encephalopathy, 1; Autosomal dominant nonsyndromic hearing loss 65; Caused by mutation in the TBC1 domain family, member 24 2024-02-01 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.