Total submissions: 2
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Labcorp Genetics |
RCV000226914 | SCV000286318 | pathogenic | Pulmonary hypertension, primary, 1 | 2015-11-19 | criteria provided, single submitter | clinical testing | This sequence change deletes the last 4 nucleotides from exon 8 and the first 16 nucleotides from intron 8 of the BMPR2 mRNA (c.1125_1128+16delCGAGGTGAGTGTATACAAAA), causing a frameshift at codon 375. This creates a premature translational stop signal (p.Ser375Argfs*13). This deletion also includes the donor splice site in intron 8. Skipping of exon 8 would also result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in BMPR2 are known to be pathogenic (PMID: 16429395, 20534176). For these reasons, this variant has been classified as Pathogenic. |
Labcorp Genetics |
RCV001380225 | SCV001578209 | pathogenic | Primary pulmonary hypertension | 2015-11-19 | criteria provided, single submitter | clinical testing | This sequence change deletes the last  4 nucleotides from exon 8 and the first 16 nucleotides from intron 8 of the BMPR2 mRNA (c.1125_1128+16delCGAGGTGAGTGTATACAAAA), causing a frameshift at codon 375. This creates a premature translational stop signal (p.Ser375Argfs*13). This deletion also includes the donor splice site in intron 8. Skipping of exon 8 would also result in an absent or disrupted protein product. For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, truncating variants in BMPR2 are known to be pathogenic (PMID: 16429395, 20534176). |