ClinVar Miner

Submissions for variant NM_001204.7(BMPR2):c.1125_1128+16del

dbSNP: rs878854272
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Labcorp Genetics (formerly Invitae), Labcorp RCV000226914 SCV000286318 pathogenic Pulmonary hypertension, primary, 1 2015-11-19 criteria provided, single submitter clinical testing This sequence change deletes the last 4 nucleotides from exon 8 and the first 16 nucleotides from intron 8 of the BMPR2 mRNA (c.1125_1128+16delCGAGGTGAGTGTATACAAAA), causing a frameshift at codon 375. This creates a premature translational stop signal (p.Ser375Argfs*13). This deletion also includes the donor splice site in intron 8. Skipping of exon 8 would also result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in BMPR2 are known to be pathogenic (PMID: 16429395, 20534176). For these reasons, this variant has been classified as Pathogenic.
Labcorp Genetics (formerly Invitae), Labcorp RCV001380225 SCV001578209 pathogenic Primary pulmonary hypertension 2015-11-19 criteria provided, single submitter clinical testing This sequence change deletes the last  4 nucleotides from exon 8 and the first 16 nucleotides from intron 8 of the BMPR2 mRNA (c.1125_1128+16delCGAGGTGAGTGTATACAAAA), causing a frameshift at codon 375. This creates a premature translational stop signal (p.Ser375Argfs*13). This deletion also includes the donor splice site in intron 8. Skipping of exon 8 would also result in an absent or disrupted protein product. For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, truncating variants in BMPR2 are known to be pathogenic (PMID: 16429395, 20534176).

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.