ClinVar Miner

Submissions for variant NM_001258392.3(CLPB):c.456-99GCCATACACTGAAAATATTCCTCTGTCTTGTTTTAGGCTGTTGTCAGAAGGTGCAGATGTCAA[4]

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Labcorp Genetics (formerly Invitae), Labcorp RCV005195639 SCV005837143 uncertain significance 3-methylglutaconic aciduria, type VIIB 2024-09-29 criteria provided, single submitter clinical testing This sequence change falls in intron 2 of the CLPB gene. It does not directly change the encoded amino acid sequence of the CLPB protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CLPB-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the effect of this variant on mRNA splicing is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.