Total submissions: 4
| Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
|---|---|---|---|---|---|---|---|---|
| Eurofins Ntd Llc |
RCV000288609 | SCV000339615 | uncertain significance | not provided | 2016-02-12 | criteria provided, single submitter | clinical testing | |
| Ambry Genetics | RCV002379135 | SCV002671187 | uncertain significance | Cardiovascular phenotype | 2022-01-12 | criteria provided, single submitter | clinical testing | The c.73922_73945del24 variant (also known as p.V24641_P24648del) is located in coding exon 185 of the TTN gene. This variant results from an in-frame TCAACTTAACATGGACTGAGCCAG deletion at nucleotide positions 73922 to 73945. This results in the in-frame deletion of eight amino acids from codon 24641 to 24648. This amino acid position is not well to highly conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. |
| Women's Health and Genetics/Laboratory Corporation of America, |
RCV004701380 | SCV005204345 | uncertain significance | not specified | 2024-06-12 | criteria provided, single submitter | clinical testing | Variant summary: TTN c.93413_93436del24 (p.Val31138_Pro31145del) results in an in-frame deletion that is predicted to remove 8 amino acids from the M-band region of the encoded protein. The variant allele was found at a frequency of 4e-06 in 248746 control chromosomes. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. c.93413_93436del24 has been reported in the literature in one unspecified individual affected with Limb-Girdle Muscular Dystrophy (Nallamilli_2018 through LOVD). These report(s) do not provide unequivocal conclusions about association of the variant with Limb-Girdle Muscular Dystrophy, Type 2J. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publication has been ascertained in the context of this evaluation (PMID: 30564623). ClinVar contains an entry for this variant (Variation ID: 286259). Based on the evidence outlined above, the variant was classified as uncertain significance. |
| Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, |
RCV002379135 | SCV006066828 | uncertain significance | Cardiovascular phenotype | 2025-04-09 | criteria provided, single submitter | clinical testing |