ClinVar Miner

Submissions for variant NM_001267550.2(TTN):c.101117_101140del (p.Val33706_Pro33713del)

dbSNP: rs886043352
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 3
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Eurofins Ntd Llc (ga) RCV000288609 SCV000339615 uncertain significance not provided 2016-02-12 criteria provided, single submitter clinical testing
Ambry Genetics RCV002379135 SCV002671187 uncertain significance Cardiovascular phenotype 2022-01-12 criteria provided, single submitter clinical testing The c.73922_73945del24 variant (also known as p.V24641_P24648del) is located in coding exon 185 of the TTN gene. This variant results from an in-frame TCAACTTAACATGGACTGAGCCAG deletion at nucleotide positions 73922 to 73945. This results in the in-frame deletion of eight amino acids from codon 24641 to 24648. This amino acid position is not well to highly conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
Women's Health and Genetics/Laboratory Corporation of America, LabCorp RCV004701380 SCV005204345 uncertain significance not specified 2024-06-12 criteria provided, single submitter clinical testing Variant summary: TTN c.93413_93436del24 (p.Val31138_Pro31145del) results in an in-frame deletion that is predicted to remove 8 amino acids from the M-band region of the encoded protein. The variant allele was found at a frequency of 4e-06 in 248746 control chromosomes. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. c.93413_93436del24 has been reported in the literature in one unspecified individual affected with Limb-Girdle Muscular Dystrophy (Nallamilli_2018 through LOVD). These report(s) do not provide unequivocal conclusions about association of the variant with Limb-Girdle Muscular Dystrophy, Type 2J. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publication has been ascertained in the context of this evaluation (PMID: 30564623). ClinVar contains an entry for this variant (Variation ID: 286259). Based on the evidence outlined above, the variant was classified as uncertain significance.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.