ClinVar Miner

Submissions for variant NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[3] (p.11363_11369VLPEEEE[5]) (rs397517548)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 4
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine RCV000040170 SCV000063861 uncertain significance not specified 2015-02-10 criteria provided, single submitter clinical testing The p.Val10140_Glu10146dup variant in TTN has not been previously reported in in dividuals with cardiomyopathy. Data from large population studies is insufficien t to assess the frequency of this variant. This variant results in the duplicati on of a stretch of 7 amino acids that are repeated multiple times in this region of the protein, and is not predicted to alter the protein reading-frame. Variat ions in the number of repeats of the seven amino acids are naturally present in other species (including rhesus monkey), suggesting that variation in this regio n may be tolerated. However, this information is not predictive enough to rule o ut pathogenicity. In summary, the clinical significance of the p.Val10140_Glu101 46dup variant is uncertain.
Invitae RCV000466929 SCV000542896 uncertain significance Dilated cardiomyopathy 1G; Limb-girdle muscular dystrophy, type 2J 2016-09-23 criteria provided, single submitter clinical testing
Genomic Research Center, Shahid Beheshti University of Medical Sciences RCV000040170 SCV000930328 uncertain significance not specified 2019-04-27 criteria provided, single submitter clinical testing
CeGaT Praxis fuer Humangenetik Tuebingen RCV000997502 SCV001152969 uncertain significance not provided 2018-08-01 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.