Submissions for variant NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3])

dbSNP: rs587780487

Total submissions: 11

Submitter	RCV	SCV	Clinical significance	Condition	Last evaluated	Review status	Method	Comment
Genetic Services Laboratory, University of Chicago	RCV000118749	SCV000153250	uncertain significance	not provided	2013-12-02	criteria provided, single submitter	clinical testing
Labcorp Genetics (formerly Invitae), Labcorp	RCV001081662	SCV000286593	benign	Dilated cardiomyopathy 1G; Autosomal recessive limb-girdle muscular dystrophy type 2J	2024-01-29	criteria provided, single submitter	clinical testing
GeneDx	RCV000602183	SCV000729419	benign	not specified	2018-01-30	criteria provided, single submitter	clinical testing	This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease.
Center for Advanced Laboratory Medicine, UC San Diego Health, University of California San Diego	RCV000852871	SCV000995605	likely benign	Cardiomyopathy	2019-01-22	criteria provided, single submitter	clinical testing
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute	RCV001256704	SCV001433107	uncertain significance	Arrhythmogenic right ventricular dysplasia 1	2019-01-30	criteria provided, single submitter	clinical testing
Genetics and Genomics Program, Sidra Medicine	RCV001293148	SCV001434138	uncertain significance	Hypertrophic cardiomyopathy		criteria provided, single submitter	research
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories	RCV000118749	SCV001474317	benign	not provided	2020-06-02	criteria provided, single submitter	clinical testing
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine	RCV000602183	SCV001653060	benign	not specified	2020-06-14	criteria provided, single submitter	clinical testing	The p.Val10140_Glu10146del variant in TTN is classified as benign because it has been identified in 0.56% (173/30572) of South Asian chromosomes, including 4 homozygotes, by gnomAD (http://gnomad.broadinstitute.org). ACMG/AMP Criteria applied: BA1.
Women's Health and Genetics/Laboratory Corporation of America, LabCorp	RCV000602183	SCV002051302	benign	not specified	2021-12-20	criteria provided, single submitter	clinical testing	Variant summary: TTN c.30418_30438del21 (p.Val10140_Glu10146del) results in an in-frame deletion that is predicted to remove seven amino acids from the encoded protein. The variant allele was found at a frequency of 0.0013 in 248956 control chromosomes, predominantly at a frequency of 0.0057 within the South Asian subpopulation in the gnomAD database, including 4 homozygotes. The observed variant frequency within South Asian control individuals in the gnomAD database is approximately 14 fold of the estimated maximal expected allele frequency for a pathogenic variant in TTN causing Dilated Cardiomyopathy phenotype (0.00039), strongly suggesting that the variant is a benign polymorphism found primarily in populations of South Asian origin. To our knowledge, no occurrence of c.30418_30438del21 in individuals affected with Dilated Cardiomyopathy and no experimental evidence demonstrating its impact on protein function have been reported. Six clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 and classified the variant as VUS (n=1), likely benign (n=4) and benign(n=1). Based on the evidence outlined above, the variant was classified as benign.
CeGaT Center for Human Genetics Tuebingen	RCV000118749	SCV004152477	likely benign	not provided	2022-12-01	criteria provided, single submitter	clinical testing	TTN: BS2
PreventionGenetics, part of Exact Sciences	RCV004529988	SCV004728743	likely benign	TTN-related disorder	2020-11-16	no assertion criteria provided	clinical testing	This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).