ClinVar Miner

Submissions for variant NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3])

dbSNP: rs587780487
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 11
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Genetic Services Laboratory, University of Chicago RCV000118749 SCV000153250 uncertain significance not provided 2013-12-02 criteria provided, single submitter clinical testing
Labcorp Genetics (formerly Invitae), Labcorp RCV001081662 SCV000286593 benign Dilated cardiomyopathy 1G; Autosomal recessive limb-girdle muscular dystrophy type 2J 2024-01-29 criteria provided, single submitter clinical testing
GeneDx RCV000602183 SCV000729419 benign not specified 2018-01-30 criteria provided, single submitter clinical testing This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease.
Center for Advanced Laboratory Medicine, UC San Diego Health, University of California San Diego RCV000852871 SCV000995605 likely benign Cardiomyopathy 2019-01-22 criteria provided, single submitter clinical testing
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute RCV001256704 SCV001433107 uncertain significance Arrhythmogenic right ventricular dysplasia 1 2019-01-30 criteria provided, single submitter clinical testing
Genetics and Genomics Program, Sidra Medicine RCV001293148 SCV001434138 uncertain significance Hypertrophic cardiomyopathy criteria provided, single submitter research
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories RCV000118749 SCV001474317 benign not provided 2020-06-02 criteria provided, single submitter clinical testing
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine RCV000602183 SCV001653060 benign not specified 2020-06-14 criteria provided, single submitter clinical testing The p.Val10140_Glu10146del variant in TTN is classified as benign because it has been identified in 0.56% (173/30572) of South Asian chromosomes, including 4 homozygotes, by gnomAD (http://gnomad.broadinstitute.org). ACMG/AMP Criteria applied: BA1.
Women's Health and Genetics/Laboratory Corporation of America, LabCorp RCV000602183 SCV002051302 benign not specified 2021-12-20 criteria provided, single submitter clinical testing Variant summary: TTN c.30418_30438del21 (p.Val10140_Glu10146del) results in an in-frame deletion that is predicted to remove seven amino acids from the encoded protein. The variant allele was found at a frequency of 0.0013 in 248956 control chromosomes, predominantly at a frequency of 0.0057 within the South Asian subpopulation in the gnomAD database, including 4 homozygotes. The observed variant frequency within South Asian control individuals in the gnomAD database is approximately 14 fold of the estimated maximal expected allele frequency for a pathogenic variant in TTN causing Dilated Cardiomyopathy phenotype (0.00039), strongly suggesting that the variant is a benign polymorphism found primarily in populations of South Asian origin. To our knowledge, no occurrence of c.30418_30438del21 in individuals affected with Dilated Cardiomyopathy and no experimental evidence demonstrating its impact on protein function have been reported. Six clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 and classified the variant as VUS (n=1), likely benign (n=4) and benign(n=1). Based on the evidence outlined above, the variant was classified as benign.
CeGaT Center for Human Genetics Tuebingen RCV000118749 SCV004152477 likely benign not provided 2022-12-01 criteria provided, single submitter clinical testing TTN: BS2
PreventionGenetics, part of Exact Sciences RCV004529988 SCV004728743 likely benign TTN-related disorder 2020-11-16 no assertion criteria provided clinical testing This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.