ClinVar Miner

Submissions for variant NM_001267550.2(TTN):c.52576_52603del (p.Asn17525_Ala17526insTer)

dbSNP: rs1064792915
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 3
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV000466289 SCV000542489 likely pathogenic Dilated cardiomyopathy 1G 2016-10-03 criteria provided, single submitter clinical testing This sequence change deletes 28 nucleotide from exon 275 of the TTN mRNA (c.52576_52603delGCCTTGAAAGCCAATGTAGATGGCTTAT), causing a frameshift at codon 17526. This creates a premature translational stop signal in the last exon of the TTN mRNA (p.Ala17526*). While this is not anticipated to result in nonsense mediated decay, it is expected to result in a truncated TTN protein. This variant is found in the A-band of this gene. While this particular variant has not been reported in the literature, truncating variants in the A-band of TTN are significantly overrepresented in patients with dilated cardiomyopathy and are considered to be likely pathogenic for the disease (PMID: 25589632). For these reasons, this variant has been classified as Likely Pathogenic.
Invitae RCV001379022 SCV001576740 likely pathogenic Dilated cardiomyopathy 1G; Autosomal recessive limb-girdle muscular dystrophy type 2J 2022-09-13 criteria provided, single submitter clinical testing This variant has not been reported in the literature in individuals affected with TTN-related conditions. In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant is located in the A band of TTN (PMID: 25589632). Truncating variants in this region are significantly overrepresented in patients affected with dilated cardiomyopathy (PMID: 25589632). Truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). ClinVar contains an entry for this variant (Variation ID: 404765). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Ala17526*) in the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein.
Ambry Genetics RCV003168739 SCV003856889 likely pathogenic Cardiovascular phenotype 2023-01-20 criteria provided, single submitter clinical testing The c.25381_25408del28 variant, located in coding exon 102 of the TTN gene, results from a deletion of 28 nucleotides at nucleotide positions 25381 to 25408, causing a translational frameshift with a predicted alternate stop codon (p.A8461*). This exon is located in the A-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the A-band are the most common cause of dilated cardiomyopathy (DCM) (Herman DS et al. N. Engl. J. Med., 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med, 2015 Jan;7:270ra6). TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with DCM regardless of their position in titin (Schafer S et al. Nat. Genet., 2017 01;49:46-53). Based on the majority of available evidence to date, this variant is likely to be pathogenic.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.