ClinVar Miner

Submissions for variant NM_001267550.2(TTN):c.78588_78624dup (p.Glu26209fs)

dbSNP: rs1706342425
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario RCV001171260 SCV001333969 likely pathogenic Cardiomyopathy 2020-01-21 criteria provided, single submitter clinical testing
Ambry Genetics RCV003163377 SCV003858682 likely pathogenic Cardiovascular phenotype 2023-02-10 criteria provided, single submitter clinical testing The c.51393_51429dup37 variant, located in coding exon 153 of the TTN gene, results from a duplication of TCCAAAATTCAGAGACACAATTGTGGTAAATGCTGGA at nucleotide position 51393, causing a translational frameshift with a predicted alternate stop codon (p.E17144Sfs*18). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This exon is located in the A-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the A-band are the most common cause of dilated cardiomyopathy (DCM) (Herman DS et al. N. Engl. J. Med., 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med, 2015 Jan;7:270ra6). TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with DCM regardless of their position in titin (Schafer S et al. Nat. Genet., 2017 01;49:46-53). Based on the majority of available evidence to date, this variant is likely to be pathogenic.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.