Total submissions: 2
| Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
|---|---|---|---|---|---|---|---|---|
| CHEO Genetics Diagnostic Laboratory, |
RCV001171260 | SCV001333969 | likely pathogenic | Cardiomyopathy | 2020-01-21 | criteria provided, single submitter | clinical testing | |
| Ambry Genetics | RCV003163377 | SCV003858682 | likely pathogenic | Cardiovascular phenotype | 2023-02-10 | criteria provided, single submitter | clinical testing | The c.51393_51429dup37 variant, located in coding exon 153 of the TTN gene, results from a duplication of TCCAAAATTCAGAGACACAATTGTGGTAAATGCTGGA at nucleotide position 51393, causing a translational frameshift with a predicted alternate stop codon (p.E17144Sfs*18). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This exon is located in the A-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the A-band are the most common cause of dilated cardiomyopathy (DCM) (Herman DS et al. N. Engl. J. Med., 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med, 2015 Jan;7:270ra6). TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with DCM regardless of their position in titin (Schafer S et al. Nat. Genet., 2017 01;49:46-53). Based on the majority of available evidence to date, this variant is likely to be pathogenic. |