Total submissions: 2
| Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
|---|---|---|---|---|---|---|---|---|
| Invitae | RCV001377001 | SCV001574217 | likely pathogenic | Dilated cardiomyopathy 1G; Autosomal recessive limb-girdle muscular dystrophy type 2J | 2021-10-09 | criteria provided, single submitter | clinical testing | This variant is located in the A band of TTN (PMID: 25589632). Truncating variants in this region are significantly overrepresented in patients affected with dilated cardiomyopathy (PMID: 25589632). Truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). This sequence change creates a premature translational stop signal (p.Lys32094Leufs*26) in the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant has not been reported in the literature in individuals affected with TTN-related conditions. This variant is not present in population databases (ExAC no frequency). |
| Ambry Genetics | RCV002377561 | SCV002667517 | likely pathogenic | Cardiovascular phenotype | 2020-03-19 | criteria provided, single submitter | clinical testing | The c.69065_69084dup20 variant, located in coding exon 173 of the TTN gene, results from a duplication of CTGAAAACCAATCTGGCAAG at nucleotide position 69065, causing a translational frameshift with a predicted alternate stop codon (p.K23029Lfs*26). This exon is located in the A-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the A-band are the most common cause of dilated cardiomyopathy (DCM) (Herman DS et al. N. Engl. J. Med., 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med, 2015 Jan;7:270ra6). TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with DCM regardless of their position in titin (Schafer S et al. Nat. Genet., 2017 01;49:46-53). As such, this alteration is classified as likely pathogenic. |