ClinVar Miner

Submissions for variant NM_001572.5(IRF7):c.848-75CTGTCCCCGCCCACCCCCGTCACTCACAGC[3]

dbSNP: rs777061273
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Labcorp Genetics (formerly Invitae), Labcorp RCV001926943 SCV002202633 uncertain significance Immunodeficiency 39 2021-03-29 criteria provided, single submitter clinical testing In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with IRF7-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change falls in intron 6 of the IRF7 gene. It does not directly change the encoded amino acid sequence of the IRF7 protein.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.