ClinVar Miner

Submissions for variant NM_001849.3(COL6A2):c.1641_1667del (p.Gly549_Pro557del) (rs1555874762)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV000541574 SCV000657115 uncertain significance Bethlem myopathy 1 2016-12-25 criteria provided, single submitter clinical testing This sequence change deletes 27 nucleotides from exon 21 of the COL6A2 mRNA (c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA). This leads to the deletion of 9 amino acid residues in the COL6A2 protein (p.Gly549_Pro557del) but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a COL6A2-related disease. This deletion is located with the functionally conserved triple helix region of the COL6A2 protein (PMID: 7695699, 19344236) and a significant number of previously reported COL6A2 missense mutations and in-frame deletions have been found within this domain (PMID: 24038877, 15563506, 24271325). However, experimental studies and prediction algorithms are not available for this variant, and the functional significance of deleting these amino acids is currently unknown. In summary, this variant is a novel in-frame deletion with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.