ClinVar Miner

Submissions for variant NM_003172.4(SURF1):c.-11_13del (p.Met1_Ala5del)

dbSNP: rs863224229
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 4
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
GeneDx RCV000199102 SCV000252358 pathogenic not provided 2012-03-12 criteria provided, single submitter clinical testing The c.-11_c.13delGGCCGGGTGCGATGGCGGCGGTGG mutation in the SURF1 gene is predicted to result in the loss of the initiator Methionine codon. As this mutation results in the deletion of the translation initiator codon, it is predicted to prevent protein translation, or if translation proceeded with an alternate methionine, would lead to an abnormal protein product. Although this mutation has not been reported previously to our knowledge, it is expected to be a disease-causing mutation. The variant is found in MITO24 panel(s).
Invitae RCV000258857 SCV000752481 pathogenic Leigh syndrome 2023-09-08 criteria provided, single submitter clinical testing Disruption of the initiator codon has been observed in individual(s) with Leigh syndrome (PMID: 27756633). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. For these reasons, this variant has been classified as Pathogenic. Experimental studies have shown that disruption of the initiator codon affects SURF1 function (PMID: 27756633). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. ClinVar contains an entry for this variant (Variation ID: 215241). This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the SURF1 mRNA. The next in-frame methionine is located at codon 110.
Fulgent Genetics, Fulgent Genetics RCV002492908 SCV002790714 pathogenic Cytochrome-c oxidase deficiency disease; Charcot-Marie-Tooth disease type 4K 2022-02-23 criteria provided, single submitter clinical testing
Center for Neuroscience and Cell Biology, University of Coimbra, Portugal RCV000258857 SCV000264571 likely pathogenic Leigh syndrome 2015-12-28 no assertion criteria provided research

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.