Total submissions: 4
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Gene |
RCV000199102 | SCV000252358 | pathogenic | not provided | 2012-03-12 | criteria provided, single submitter | clinical testing | The c.-11_c.13delGGCCGGGTGCGATGGCGGCGGTGG mutation in the SURF1 gene is predicted to result in the loss of the initiator Methionine codon. As this mutation results in the deletion of the translation initiator codon, it is predicted to prevent protein translation, or if translation proceeded with an alternate methionine, would lead to an abnormal protein product. Although this mutation has not been reported previously to our knowledge, it is expected to be a disease-causing mutation. The variant is found in MITO24 panel(s). |
Invitae | RCV000258857 | SCV000752481 | pathogenic | Leigh syndrome | 2023-09-08 | criteria provided, single submitter | clinical testing | Disruption of the initiator codon has been observed in individual(s) with Leigh syndrome (PMID: 27756633). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. For these reasons, this variant has been classified as Pathogenic. Experimental studies have shown that disruption of the initiator codon affects SURF1 function (PMID: 27756633). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. ClinVar contains an entry for this variant (Variation ID: 215241). This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the SURF1 mRNA. The next in-frame methionine is located at codon 110. |
Fulgent Genetics, |
RCV002492908 | SCV002790714 | pathogenic | Cytochrome-c oxidase deficiency disease; Charcot-Marie-Tooth disease type 4K | 2022-02-23 | criteria provided, single submitter | clinical testing | |
Center for Neuroscience and Cell Biology, |
RCV000258857 | SCV000264571 | likely pathogenic | Leigh syndrome | 2015-12-28 | no assertion criteria provided | research |